ID: 914909766

View in Genome Browser
Species Human (GRCh38)
Location 1:151775517-151775539
Sequence CCAAAGCTTCCTCTTCCCAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 573}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914909763_914909766 22 Left 914909763 1:151775472-151775494 CCAGAGGCTTCCAGTCAGCACAA 0: 1
1: 0
2: 0
3: 16
4: 167
Right 914909766 1:151775517-151775539 CCAAAGCTTCCTCTTCCCACTGG 0: 1
1: 0
2: 4
3: 47
4: 573
914909764_914909766 12 Left 914909764 1:151775482-151775504 CCAGTCAGCACAATGAGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 914909766 1:151775517-151775539 CCAAAGCTTCCTCTTCCCACTGG 0: 1
1: 0
2: 4
3: 47
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914909766 Original CRISPR CCAAAGCTTCCTCTTCCCAC TGG Exonic
900437353 1:2637496-2637518 CAACAGCCTCCCCTTCCCACTGG - Intronic
900540354 1:3199630-3199652 TCAAAGCATCCTCATCCCATGGG + Intronic
900618105 1:3574405-3574427 CCAAACCTTCCCCAGCCCACAGG + Intronic
900763394 1:4487851-4487873 ACATTGCTTCCTCTTGCCACGGG - Intergenic
900960778 1:5917904-5917926 CCAAGGCCTCCCCTTCCTACTGG + Intronic
901474190 1:9478377-9478399 ACAACGCTTCCTCCTGCCACAGG + Intergenic
901657223 1:10776422-10776444 CCACAGCTGCCTCTTGTCACAGG + Intronic
902631938 1:17709929-17709951 CCAAAGCTCCCCTTTCCCCCTGG - Intergenic
902773936 1:18662169-18662191 CCAAAGCTCCCTCTCCTCCCAGG - Intronic
903315253 1:22498693-22498715 CGAAAGCTTCCCTTCCCCACTGG + Intronic
903770288 1:25759477-25759499 CCAAAGCCTTGTCTTCCCCCTGG + Intronic
904116179 1:28163698-28163720 CCAAGCCTCCCTCTCCCCACTGG + Intronic
904971445 1:34422137-34422159 ACCAAGCTTCCTCTTCCCATGGG - Intergenic
905817741 1:40965156-40965178 CCAGAGCCTGCTGTTCCCACAGG - Intergenic
906111105 1:43322629-43322651 CTAAAGCTTGCTCTGCCCCCAGG + Exonic
906258041 1:44365650-44365672 CCAAAGCTTCCATTTCCAACAGG + Intergenic
907953594 1:59207028-59207050 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
908403099 1:63789236-63789258 CCAGACCTTCTTCTTGCCACAGG + Intronic
908582056 1:65526034-65526056 CCAGATCTTCCTCGCCCCACGGG - Intronic
910177253 1:84443614-84443636 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
910626971 1:89317165-89317187 CCAAAGCTGCCCCTTCCACCAGG - Intergenic
910799575 1:91131769-91131791 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
912894823 1:113575786-113575808 CCACAGCTGCCCCTTCCCCCAGG + Intronic
913021394 1:114791937-114791959 CCACAGCCTCCCCTTCCCCCAGG + Intergenic
914909766 1:151775517-151775539 CCAAAGCTTCCTCTTCCCACTGG + Exonic
915265739 1:154716047-154716069 CCAGAGCTTCCTCTTCCCCAGGG + Intronic
916090745 1:161306225-161306247 ACACAGCTTCCTCTTCCCCTTGG + Intronic
916261490 1:162846749-162846771 CCTGGGCTTCCTCCTCCCACTGG + Intronic
916612754 1:166409503-166409525 ACACAGCTGCCTCTTCCCCCAGG + Intergenic
916625547 1:166552015-166552037 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
917163093 1:172080219-172080241 CCACAGCTGCCCCTTCCCCCAGG + Intronic
917401321 1:174652893-174652915 CCACAGCCTCCCCTTCCCCCAGG + Intronic
917584929 1:176416765-176416787 CCACAGCTACTTCTTCCCCCAGG + Intergenic
918360346 1:183751158-183751180 CCACAGCTGCCCCTTCCCCCAGG + Intronic
919599042 1:199600011-199600033 CCACAGCTGCCCCTTCCTACAGG - Intergenic
919743915 1:200996738-200996760 CAAACTCTTCCCCTTCCCACAGG - Intronic
921591788 1:217012645-217012667 CTCAAGCTGCCTCTCCCCACTGG + Intronic
922025098 1:221742464-221742486 CTAAAACTGGCTCTTCCCACTGG + Intergenic
922198147 1:223377650-223377672 CCAGAGCTTCCCCTTCTCATAGG + Intergenic
922214761 1:223511256-223511278 CCAGAGCTTCCTCTGTTCACAGG + Intergenic
922716060 1:227872732-227872754 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
923346246 1:233055587-233055609 CCAATGCTTACTCCACCCACAGG - Intronic
923465201 1:234242085-234242107 CCCACGATTCCTGTTCCCACTGG - Intronic
923832666 1:237575121-237575143 CCAAGGATTCCTCTTCCAACAGG + Intronic
924286218 1:242490080-242490102 CTGAAGCTTCCTCTCCACACAGG + Intronic
1063351204 10:5357073-5357095 CCAAAGCATCCTGTTTCCCCAGG + Intergenic
1063662970 10:8046512-8046534 CCAAAGCCTCCTCTGCCTAGCGG + Intergenic
1065075952 10:22079885-22079907 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1065120947 10:22530074-22530096 CCATAGCTGCCCCTTCCCTCAGG + Intergenic
1065955670 10:30691752-30691774 CTAAGGGTTTCTCTTCCCACGGG + Intergenic
1066582038 10:36891545-36891567 TCACAGCTGCATCTTCCCACTGG - Intergenic
1067332222 10:45333220-45333242 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1068357056 10:55923103-55923125 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1068469909 10:57448074-57448096 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1071228785 10:83562336-83562358 CCAAAGCTGCCACTACCCACAGG + Intergenic
1073624992 10:105087980-105088002 CCAAAGCATCCTTATCCCAGTGG - Intronic
1074016708 10:109542167-109542189 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1075569181 10:123526865-123526887 GGAAAGCTTCCTCTTTCCAACGG - Intergenic
1076262598 10:129079547-129079569 TCAGCGCTTCCTCTTCCCTCTGG - Intergenic
1077561997 11:3270008-3270030 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1077567891 11:3315828-3315850 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1078336405 11:10466585-10466607 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1078392851 11:10951860-10951882 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1078431217 11:11290197-11290219 CCAAAGTCTCCTCTTAGCACAGG - Intronic
1078809374 11:14743160-14743182 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1079168211 11:18066729-18066751 CCAATGCTTCCACTCCACACTGG + Intergenic
1079696173 11:23484565-23484587 CCACAGCCACCTCTTCCCCCTGG - Intergenic
1080334589 11:31181259-31181281 CCACAGCCTCCCCTTCCCCCAGG - Intronic
1080787993 11:35493520-35493542 CCCATGCTTCCTCTTGCCACAGG + Intronic
1081118329 11:39232608-39232630 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1081869137 11:46375410-46375432 CCCAAGCTTCCTGTGCCCACAGG + Exonic
1082783149 11:57302252-57302274 CCATTGCTGCCTCATCCCACGGG + Intronic
1084657579 11:70528287-70528309 CCAAACCTTCCTGCTTCCACCGG - Intronic
1085423509 11:76383113-76383135 CCAGATCCTCCTCTTCCAACAGG - Intronic
1085449303 11:76622528-76622550 CCAAGGCATCCTCTTCTCAGGGG - Intergenic
1085683748 11:78603030-78603052 CCACAGCTGCCCCTTCCCCCGGG + Intergenic
1086129249 11:83383513-83383535 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1086410760 11:86541691-86541713 CCAAAGCTGCCCCTTCCCTGAGG - Intronic
1086760910 11:90629647-90629669 CCAAAGCTTCCTATTCCTTGAGG + Intergenic
1087326320 11:96727720-96727742 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1087596167 11:100257330-100257352 CCACAGCTGCCCCTTCCCCCTGG - Intronic
1088034582 11:105296347-105296369 CCACAGCCACCCCTTCCCACAGG + Intergenic
1089285424 11:117404749-117404771 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1090238692 11:125166776-125166798 TCCAAGCTTCCTCCTCCCCCGGG - Intronic
1091013769 11:132030677-132030699 CCAAAGCATACTCCTGCCACAGG - Intronic
1092628909 12:10358122-10358144 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1092703302 12:11256890-11256912 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1092999256 12:13980341-13980363 CCAAAGCGTCCCCTTCCTAAGGG + Intergenic
1093333260 12:17868943-17868965 CCACAGCCTCCCCTTCCCCCAGG - Intergenic
1093530841 12:20161195-20161217 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1093694810 12:22147027-22147049 CCACAGCCTCCCCTTCCCCCAGG - Intronic
1093835552 12:23824683-23824705 CCACAGCCTCCCCTTCCCCCAGG + Intronic
1094426469 12:30321640-30321662 CCACACCATCCTCTTCCCATTGG + Intergenic
1095406393 12:41871074-41871096 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1095488538 12:42708736-42708758 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1095778922 12:46037423-46037445 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1097435516 12:59548981-59549003 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1097635148 12:62113588-62113610 CCAGAGCTGCCCCTTCCCCCAGG + Intronic
1097898751 12:64853085-64853107 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1098052983 12:66473371-66473393 CCATAGCTGCCCCTTCCCCCAGG - Intronic
1098360515 12:69649987-69650009 TCAAACCTTCCTTTTGCCACAGG - Intronic
1098706936 12:73702846-73702868 CCATAGCTGCCCCTTCCCCCTGG - Intergenic
1098780209 12:74676928-74676950 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1099435219 12:82634756-82634778 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1099486204 12:83232405-83232427 CCACAGCTGACCCTTCCCACAGG + Intergenic
1100073881 12:90755080-90755102 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1101206545 12:102493980-102494002 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1101344964 12:103878505-103878527 CTCAAGCCTCTTCTTCCCACTGG + Intergenic
1101441646 12:104708590-104708612 CCAAGGCTTCATCTTCCTCCAGG + Intronic
1101565469 12:105900950-105900972 CCAAAGCTTGTTTTTCCCATTGG - Intergenic
1101668558 12:106844420-106844442 CCAAAGCATCCTCTTGTCTCAGG - Intronic
1102079931 12:110089728-110089750 CCAAAACTCCCTCTTTTCACTGG + Intergenic
1102345527 12:112158789-112158811 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1103169107 12:118798739-118798761 CCACAGCCGCCTCTTCCCCCAGG + Intergenic
1103253533 12:119521572-119521594 CCTAAGCTTCCTCCTGCCGCAGG - Intronic
1103462911 12:121119344-121119366 CCAAAACTCCCTCTTTTCACTGG - Intergenic
1104339682 12:127936581-127936603 CCAGAGATTTCTCTTCTCACAGG - Intergenic
1105316515 13:19270349-19270371 CCATAGCTGCCCCTTCCCCCAGG - Intergenic
1105552428 13:21410455-21410477 CTACAGCTGCCTCTTCCCCCAGG + Intronic
1106103836 13:26717152-26717174 CCCAAGCTCCCTCATCCCTCAGG + Intergenic
1106326291 13:28693655-28693677 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1106429475 13:29666117-29666139 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1107473410 13:40712463-40712485 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1107551426 13:41479901-41479923 CCAAAGCTGCCCCTTTCCCCAGG + Intergenic
1107648215 13:42516831-42516853 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1108048763 13:46408688-46408710 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1108217743 13:48201422-48201444 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1109163390 13:59003865-59003887 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1109541296 13:63782033-63782055 CCACAGCTGCCCCTTCCCTCAGG + Intergenic
1109902757 13:68795473-68795495 CCACAGCTGCCCCTTCCCTCAGG + Intergenic
1110019997 13:70457849-70457871 CCACAGCTGCCCCTTCCCTCAGG - Intergenic
1111251102 13:85602510-85602532 CCTAAGCTTCATCTACCCAATGG - Intergenic
1112151973 13:96773721-96773743 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1112165898 13:96919261-96919283 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1112429233 13:99335824-99335846 CCATAGCTTCACCTTCCCTCGGG + Intronic
1112546468 13:100376445-100376467 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1112968701 13:105232183-105232205 TCAAAGCCTCTTCTTCACACGGG + Intergenic
1113557468 13:111249906-111249928 CCCAAGCTTCACTTTCCCACTGG + Intronic
1113750472 13:112773405-112773427 CCATGGCTTTCTCTTCCCACGGG + Intronic
1114482995 14:23047005-23047027 ACAAAGCTTCATCGTCCCAAAGG - Intergenic
1115008132 14:28511366-28511388 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1115357216 14:32461106-32461128 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1115359756 14:32488124-32488146 CCACAGCTACCCCTTCCCCCAGG + Intronic
1115940285 14:38601412-38601434 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1116775770 14:49179021-49179043 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1117109764 14:52439362-52439384 CTCAAGATTCCTCTCCCCACTGG + Exonic
1117600049 14:57365458-57365480 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1117655516 14:57951829-57951851 CCATAGCCGCCTCTTCCCTCTGG - Intronic
1117710745 14:58526104-58526126 CCACAGCCGCCCCTTCCCACAGG - Intronic
1119638027 14:76292654-76292676 CCAAAGTTTGCTCTACCCTCAGG - Intergenic
1121699857 14:95944400-95944422 CCCAAGATTCCTCTTTCCTCTGG + Intergenic
1122145679 14:99687669-99687691 CCAAGGTTTTCTCTGCCCACAGG + Intronic
1122559927 14:102605837-102605859 CCATACCTTCCTTGTCCCACTGG - Intronic
1123135582 14:106025084-106025106 GCACAGCTGCCTCCTCCCACAGG + Intergenic
1123428366 15:20191802-20191824 CCAAAGGTCCCTCTTCTCAAGGG - Intergenic
1124209695 15:27752823-27752845 CCACAGCTGCCTCCTCTCACTGG + Intergenic
1124601194 15:31134012-31134034 CCAGGGCATCCTCTTCCCAGAGG - Intronic
1124848903 15:33317099-33317121 CCAAAGCTACCGTTTCCCATAGG + Intronic
1125288567 15:38120267-38120289 CCACAGCTCCCCCTTCCCCCAGG - Intergenic
1125990028 15:44097286-44097308 ACAAAGCTTGCTGTTCCTACAGG - Intronic
1126469236 15:48989750-48989772 CCAACCCTTACTCTTCCCACTGG + Exonic
1126850951 15:52796418-52796440 CCCAAACTTCCTCACCCCACCGG - Intergenic
1127363023 15:58261589-58261611 CTAAAGCTTTCTTTTCCCTCTGG - Intronic
1127468927 15:59273170-59273192 CCACAGCTTCATCTACCCAAGGG - Intronic
1129178431 15:73856611-73856633 CTAAAGCTTCCTCTCGCCCCTGG - Intergenic
1129178953 15:73859496-73859518 CCAAGGCCTCCTTATCCCACTGG - Intergenic
1130441971 15:83963551-83963573 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1131055208 15:89370875-89370897 CCCAAGCCTCCTCTGGCCACTGG + Intergenic
1131271327 15:90949294-90949316 CCTAAGCTGCCTCCTCCCCCAGG + Exonic
1132096470 15:98988535-98988557 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1132896032 16:2229827-2229849 CCAACGCTTCCTCCTCCTGCAGG - Intronic
1133043915 16:3075778-3075800 CCACAGCAGCCTCTTCCCTCCGG - Intronic
1134008907 16:10836722-10836744 CCATAGCACCCTTTTCCCACTGG - Intergenic
1134779482 16:16882837-16882859 CCAAAGCTTCCTCATCCTTTGGG + Intergenic
1135058587 16:19251633-19251655 TGACAGCTTCCTCTTCCCAGGGG + Intronic
1136412850 16:30086818-30086840 CCGCAGTTTCCTCTTCACACGGG + Exonic
1136625048 16:31457184-31457206 CAACAGCTACCTCTTCCCAGAGG - Intergenic
1136855952 16:33657949-33657971 CCAAAGGTCCCTCTTCTCAAGGG + Intergenic
1138151600 16:54662205-54662227 CCACAGCCTCCCCTTCCCCCAGG - Intergenic
1138360184 16:56421969-56421991 CTAAAACTTCCTCCTCCCAAGGG - Intronic
1139434260 16:66926991-66927013 CCATAACTTCCTCTTCCCACTGG - Intergenic
1141312129 16:82924770-82924792 TCAAAGCTTTCACTTCACACAGG - Intronic
1141706213 16:85666240-85666262 CCACGGCTTGCTCTTCCCATTGG - Exonic
1203117538 16_KI270728v1_random:1506428-1506450 CCAAAGGTCCCTCTTCTCAAGGG + Intergenic
1144891325 17:18495941-18495963 CCCAAGCCACCTCCTCCCACTGG - Intergenic
1145140898 17:20448376-20448398 CCCAAGCCACCTCCTCCCACTGG + Intergenic
1145794919 17:27649904-27649926 CCCAAGCCACCTCCTCCCACTGG - Intergenic
1145809413 17:27755622-27755644 CCCAAGCCACCTCCTCCCACTGG - Intergenic
1146492846 17:33294319-33294341 CCCAAGCCTCCTCTCCCCAAAGG - Intronic
1147747766 17:42705925-42705947 CCCAAGCATTCTCTTTCCACTGG - Intronic
1147791237 17:43015458-43015480 CCAAGGCTGCCTCTTCCAACAGG - Exonic
1148778042 17:50106725-50106747 CCAGCGCTCCCTCTTCCCCCGGG - Intronic
1148851417 17:50557313-50557335 CTAAGGCTTCCTCTTCTCGCAGG + Intergenic
1149189120 17:54037250-54037272 CAACAGCTTCCTTTTACCACTGG + Intergenic
1149365507 17:55939521-55939543 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1151064139 17:71131589-71131611 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1151428745 17:74048520-74048542 CCACTGCTGCCTCTTCCCCCTGG - Intergenic
1152638281 17:81439089-81439111 CCTGAGCTTCCTCTTCCCCAAGG - Intronic
1153313365 18:3699733-3699755 CCATAGCTGCCCCTTCCCCCAGG + Intronic
1153562195 18:6382909-6382931 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1153968704 18:10204939-10204961 CAAAAGCCTCTTCTTCCCTCAGG - Intergenic
1155648799 18:28115236-28115258 ACAAAGATTCCTCTGCCCACAGG + Intronic
1156430270 18:37065274-37065296 CTAACACTTCCTCTTCCCTCAGG - Intronic
1156582410 18:38393099-38393121 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1156626824 18:38919850-38919872 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1157403215 18:47403215-47403237 CCAATGCTTCCTCTCTCCTCGGG - Intergenic
1157910789 18:51615663-51615685 GCATGGCTTCCTCTTCCCTCTGG + Intergenic
1158073049 18:53496000-53496022 CCATAGCTGCCCCTTCCCCCAGG - Intronic
1159500869 18:69267526-69267548 CAAATGCTTGCTCTTCTCACAGG - Intergenic
1159661184 18:71097721-71097743 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1160076317 18:75680853-75680875 CCAAAGCATCAGCTTCCCCCCGG - Intergenic
1160157833 18:76446959-76446981 GCAAAGCTGCCTCTGCCCAGGGG + Intronic
1161810460 19:6468386-6468408 CCAGAGCTTCTTCTGCCCACGGG + Exonic
1163989924 19:20988713-20988735 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1164759408 19:30717560-30717582 CCATGGCTTCCCCTTCACACCGG - Intergenic
1165269938 19:34697186-34697208 CCAAAGCTGCCCCTTCACCCAGG - Intergenic
1165428819 19:35760007-35760029 CCAAAGCCTCTTTTTCCCCCAGG - Intronic
1165431915 19:35777715-35777737 CCCAGGCTTCCCCTTCACACTGG - Exonic
1165450342 19:35878753-35878775 CCTCAGCTCCCTCTTCCCTCAGG - Intronic
1165690130 19:37856433-37856455 GGAAGGCTCCCTCTTCCCACAGG - Intergenic
1165783582 19:38447898-38447920 CCCAAACCTCCTTTTCCCACAGG - Intronic
1166010336 19:39936470-39936492 CCAAAGCTTCCACTTCCTGTGGG - Intergenic
1166420157 19:42630428-42630450 TCATAGCTTTCTCTCCCCACTGG - Intronic
1167974061 19:53209898-53209920 CCACAGCCGCCTCTTCCCCCAGG + Intergenic
1168464659 19:56592309-56592331 AGTAAGCTGCCTCTTCCCACTGG - Intergenic
1168723652 19:58569292-58569314 CCCCAGCTTCCTCATGCCACAGG + Exonic
926080867 2:9985088-9985110 CCCAAGCCACCACTTCCCACAGG - Intronic
926532645 2:14069742-14069764 CCAAAGCTTATTCCTTCCACAGG - Intergenic
926784641 2:16507957-16507979 CCACAGCTGCTTCTTCCCCCAGG + Intergenic
927155484 2:20218997-20219019 CCACTGGTTCCTCTCCCCACTGG - Intronic
927543013 2:23928986-23929008 CCAAACCAGCCTCTTTCCACAGG - Intronic
927827170 2:26316943-26316965 CCTCAGCTTCCTCTTCCCCAAGG - Exonic
928102697 2:28448804-28448826 CCAAACCTTCCTATTCCACCAGG - Intergenic
928316220 2:30248739-30248761 CAAAAGCCTCCTCATTCCACTGG + Intronic
929659995 2:43774459-43774481 ACAAAGCCTCCTCTCCCCAGGGG + Intronic
929766333 2:44846838-44846860 CCATAGCATCCTCTTTCCCCAGG + Intergenic
929773817 2:44915383-44915405 CCAGAGCTTTCTCTTGCCCCAGG + Intergenic
929998088 2:46841834-46841856 CCTAAACTTCCTCTTCCTGCAGG - Intronic
931212047 2:60206927-60206949 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
931479102 2:62621984-62622006 CCACAGCCGCCCCTTCCCACAGG + Intergenic
931700302 2:64903676-64903698 CCAACCCCTCCTTTTCCCACCGG - Intergenic
931814881 2:65890497-65890519 CCACAGCTTCCCCTTCCCCCAGG - Intergenic
932646741 2:73510810-73510832 CCACAGCTGCCCCTTCCCCCAGG + Intronic
933166586 2:79083354-79083376 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
934049013 2:88194711-88194733 CCATAGGTGCCTCTTGCCACTGG + Intergenic
934562809 2:95321787-95321809 CCATGGTTTCCTCTTCCCTCTGG - Intronic
934666426 2:96174481-96174503 CCTTGGCCTCCTCTTCCCACTGG + Intergenic
934935297 2:98460904-98460926 CCAATGCTTCCTCTTCCTCATGG - Intronic
937104089 2:119294276-119294298 CCAAAGGTTCCTGTTGCCACAGG - Intergenic
937143183 2:119619131-119619153 CCAAAGCTGCCCCTTTCCCCAGG - Intronic
937523776 2:122742456-122742478 ACAGAGTTTCCTCTTCCCACTGG - Intergenic
937573568 2:123392219-123392241 CCACAGCCTCCCCTTCCCCCAGG - Intergenic
938168097 2:129050244-129050266 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
938168503 2:129054596-129054618 CCAAAGCTGCCGCTGCCCAGAGG + Intergenic
939840660 2:147183053-147183075 CCAGAGCTACCCCTTCCCCCAGG - Intergenic
939864499 2:147457797-147457819 CCAAAACTTCCTTTTCCCTTGGG + Intergenic
939937721 2:148313248-148313270 CCACAGCTGCCCCTTCCCCCAGG + Intronic
940846043 2:158643304-158643326 CCAATGCTTCCTCATCCCTTAGG - Intronic
940925214 2:159356520-159356542 CCACAGCTGCATCTTCCCCCAGG - Intronic
941571462 2:167175734-167175756 CCACAGCTGCCCCTTCCCCCAGG + Intronic
942214903 2:173709224-173709246 CCAAAGAGTCCTCTGCCAACAGG + Intergenic
943074600 2:183179135-183179157 CCACAGCTGCCTCTTCTCCCAGG + Intergenic
944038874 2:195331870-195331892 CCAAAGTTTCCTATTCCAAAAGG + Intergenic
944267953 2:197748779-197748801 CCACAGCTGCCCCTTCCCCCAGG - Intronic
945210840 2:207380802-207380824 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
945482158 2:210357299-210357321 CCATAGCTGCCCCTTCCCCCAGG + Intergenic
945533719 2:210986806-210986828 CCATAGCTGCCCCTTCCCCCAGG + Intergenic
945666761 2:212753311-212753333 CCACAGCTGCCCCTTCCCTCAGG - Intergenic
946362179 2:219225629-219225651 CCAGACTCTCCTCTTCCCACTGG - Intronic
947086095 2:226454487-226454509 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
947294182 2:228612704-228612726 CCAAAGCAACCTCTTCCTAAGGG + Intergenic
947311530 2:228808935-228808957 CCACAGCTGCCCCTCCCCACAGG + Intergenic
947364728 2:229381822-229381844 CCACAGCTGCCCCTTCCCCCAGG - Intronic
947861839 2:233366049-233366071 CCCAAGCTCCCTCTTGCCACAGG - Intronic
948059384 2:235032088-235032110 CCAATGTGTGCTCTTCCCACTGG - Intronic
1168921998 20:1546215-1546237 CCACAGCTGCCCCTTCCCCCCGG + Intronic
1169397000 20:5241315-5241337 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1169720755 20:8673936-8673958 CCAGAGCCCCCTCTTCCCAAGGG + Intronic
1170011497 20:11728507-11728529 CCACAGCTGCCTCTTCCCACAGG - Intergenic
1171063231 20:21987057-21987079 CCTAAGCTTCCTCCTGCCTCAGG + Intergenic
1173554286 20:43954558-43954580 CCAGAGCTCCCTCTGCACACAGG - Intronic
1173751111 20:45477756-45477778 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1174097668 20:48102178-48102200 GCAATGATTCCTCCTCCCACTGG - Intergenic
1174451327 20:50622521-50622543 CCAACTCCTCCTCTTCCCAGGGG + Intronic
1175724867 20:61310825-61310847 TCCTAGCTCCCTCTTCCCACAGG + Intronic
1176078623 20:63260619-63260641 TCAAAGCTTCCTCTGCACCCAGG - Intronic
1176310127 21:5145041-5145063 GCAAAGCACCCTCCTCCCACTGG + Intronic
1176891834 21:14327709-14327731 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1177042652 21:16132789-16132811 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1179317676 21:40259317-40259339 ACCAAGCTTCCTCTTGCCATAGG + Intronic
1179846929 21:44116995-44117017 GCAAAGCACCCTCCTCCCACTGG - Intronic
1180596285 22:16975553-16975575 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1181330013 22:22083428-22083450 CCAAAGCTTTATCATCCAACTGG - Intergenic
1182285805 22:29246166-29246188 CCGAGGCTCCCTCTTGCCACAGG - Intronic
1182428500 22:30287101-30287123 GCAGGGCCTCCTCTTCCCACTGG - Intronic
1182550890 22:31100229-31100251 CCAGAGCTTCCTGCTCCCACGGG + Intronic
1182824589 22:33253828-33253850 CCAAAGGTTCCTATGCCCAGGGG + Intronic
1183256926 22:36768451-36768473 CCAAGGATTCTTCTTCCCAGGGG + Intronic
1184195739 22:42926650-42926672 CCAAGCCCTCTTCTTCCCACAGG + Intronic
1184451073 22:44583172-44583194 CCACTGCTTGCTTTTCCCACTGG + Intergenic
1185346725 22:50313634-50313656 CCAGAGCTTCATCATCCCCCTGG - Exonic
949260995 3:2102649-2102671 CCAAGTCTTCCTCTTTCCAATGG - Intronic
949440192 3:4071839-4071861 CCACAGCTGCCCCTTCCCTCAGG - Intronic
949846141 3:8372444-8372466 CCACAGCTGCCCCTTCCCCCTGG - Intergenic
950172277 3:10847179-10847201 CCCAATCTTCTGCTTCCCACCGG - Intronic
950274129 3:11643935-11643957 CCGCCGCTTCCTCTTCCCGCAGG + Intronic
950976990 3:17257077-17257099 CAAAGGCTTCCTATTGCCACTGG - Intronic
951078027 3:18420831-18420853 CCAAGCCTTCCTCTTCCTAGCGG + Exonic
951254447 3:20432721-20432743 CCACAGCTGCCCCTTCCCCCTGG + Intergenic
951310960 3:21125400-21125422 CCACAGCTGCCCCTTCCCTCAGG - Intergenic
951415088 3:22414154-22414176 CCATAGCTGCCCCTTCCCCCAGG + Intergenic
951676392 3:25246917-25246939 CCACAGCTGCCCCTTCCCTCAGG + Intronic
953286692 3:41617145-41617167 CCACAGCTGCCCCTTCCCCCAGG - Intronic
953433401 3:42858067-42858089 CCATAGCTGCCCCTTCCCCCAGG - Intronic
954531133 3:51320870-51320892 CCACAGCTGCCCCTTCCCCCAGG - Intronic
954709548 3:52498559-52498581 CCAAAGCTCCCGCTTCCTTCTGG + Intronic
955451955 3:59078183-59078205 CAAAGCCTTCCTCTTCCCCCTGG + Intergenic
955870447 3:63432892-63432914 CCCCAGCTCCCTTTTCCCACAGG - Intronic
956157288 3:66312088-66312110 CCACAGCTGCCTGTTCCCCCAGG + Intronic
956355768 3:68390399-68390421 CCACAGCTGCCCCTTCCCATAGG - Intronic
957391670 3:79581160-79581182 CCAAGGCTTTCTCTACCCTCAGG + Intronic
959801047 3:110495561-110495583 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
959881154 3:111446702-111446724 CCACAGCCACCTCTTCCCCCAGG + Intronic
960119040 3:113927739-113927761 CCACAGCTTCCTGTTGCCCCAGG - Intronic
960177330 3:114532532-114532554 CCACAGCTGCCCCTTCCCCCAGG - Intronic
960378077 3:116927891-116927913 CCACAGCTGCCCCTTCCCCCAGG + Intronic
960491589 3:118322208-118322230 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
961676899 3:128573122-128573144 CTAAAGCCTGATCTTCCCACTGG - Exonic
962640089 3:137376895-137376917 CCACAGCTGCCTTTTCCCCCAGG + Intergenic
962914784 3:139890946-139890968 CCTAAACTTCCTCTTTCCACTGG - Intergenic
963027495 3:140933933-140933955 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
963629250 3:147712756-147712778 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
963980297 3:151529250-151529272 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
963998513 3:151739609-151739631 CCACAGCTTCCCCTTCCCCCAGG + Intronic
964010420 3:151885685-151885707 CCACAGCTTCCCCTTCCCCCAGG - Intergenic
964232532 3:154487327-154487349 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
964332637 3:155620805-155620827 CCACAGCTGCCCCTTCCCCCAGG - Intronic
964371322 3:156003684-156003706 CCACAGCTGCCCCTTCCCTCAGG + Intergenic
965137547 3:164791182-164791204 CCAAAACAACCTCTTGCCACTGG - Intergenic
966309467 3:178576887-178576909 CCACAGCTGCCCCTTCCCCCAGG - Intronic
968491329 4:892102-892124 CCAAACCTTCCTTGTCCCACAGG + Intronic
968548919 4:1212653-1212675 CCAAAGCCCCCTCCTCCCACAGG + Intronic
968761353 4:2444067-2444089 CCAGGGCCTCCTCTCCCCACAGG - Intronic
968831727 4:2935530-2935552 CCAAAGCTTCTCCTGCCCAGAGG - Intergenic
969581604 4:8068643-8068665 CAAAGGCCTCCTCTGCCCACTGG + Intronic
969795175 4:9522036-9522058 CCACAGCCTCCCCTTCCCAAAGG - Intergenic
969853385 4:9979735-9979757 CCAGGGCTTCCTATTCCCCCAGG + Intronic
969909141 4:10427667-10427689 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
970007332 4:11424419-11424441 CCTTAGCTTCCTCTACCCATGGG - Intronic
970844606 4:20521697-20521719 CTGAAGCTTCATCTTCCCTCCGG - Intronic
971004540 4:22358091-22358113 CCACAGCTGCCCCTTCCCCCAGG - Intronic
971679084 4:29673687-29673709 CCATAGCTGCCCCTTCCCCCAGG - Intergenic
972020256 4:34304497-34304519 CCAGAGCATACTCTTCCCATAGG - Intergenic
973562687 4:52152043-52152065 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
973569717 4:52225509-52225531 CAACAGCTTCCTCTTCCCTCAGG - Intergenic
973745535 4:53959952-53959974 GGAAAGCTTCCTCTGCCCCCAGG + Intronic
974106200 4:57472470-57472492 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
974814006 4:66982285-66982307 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
975335520 4:73170788-73170810 CCCACTCTTCCTCTTTCCACAGG - Intronic
975620287 4:76290250-76290272 CCACAGCTGCCCCTTCCCCCAGG + Intronic
975638837 4:76478522-76478544 CCATAGCTGCCCCTTCCCCCAGG - Intronic
975797395 4:78022533-78022555 GCAAAGATTTCTCTTCTCACAGG + Intergenic
976013861 4:80525702-80525724 CCTTGGCTTCCTCTTGCCACAGG + Intronic
976294103 4:83452454-83452476 CCGCAGCTACCTCTCCCCACGGG - Intronic
976370855 4:84286476-84286498 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
976439331 4:85055312-85055334 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
976779907 4:88747529-88747551 ACAAGGCATCATCTTCCCACTGG + Intronic
976809896 4:89089674-89089696 CCACAGCTGCCCCTTCCCCCAGG + Intronic
976959495 4:90951343-90951365 CCAAAGATTTCTCTTCTCAATGG - Intronic
977046951 4:92079530-92079552 CCACTGCTTCCCCTTCCCCCAGG - Intergenic
977989596 4:103424897-103424919 CCAGGGCTTACTCTGCCCACTGG - Intergenic
977994509 4:103485305-103485327 CCACAGCTGCCCCTTCCCCCGGG - Intergenic
978186010 4:105858005-105858027 CCACAGCTGCCCCTTCCCCCAGG + Intronic
978664340 4:111164575-111164597 CCACAGCTGTCTCTTCCCCCAGG - Intergenic
979698246 4:123638851-123638873 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
980171244 4:129292536-129292558 CCACAGCTTCCCCTTCCCCCAGG + Intergenic
980633871 4:135473543-135473565 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
980657213 4:135804904-135804926 CCACAGCTTCCACTACCCAGAGG - Intergenic
980792589 4:137638385-137638407 CTAAAGATTCCTCAACCCACTGG - Intergenic
981133938 4:141189494-141189516 CCACAGCTGCCCCTTCCCCCAGG + Intronic
981152723 4:141397835-141397857 CCAAAGTTTCCCCTGCCCTCAGG - Intergenic
981646642 4:147005831-147005853 CCAAAGCTTATTCCTACCACAGG - Intergenic
981864956 4:149406457-149406479 CCCATGCTCCCTCTTGCCACAGG - Intergenic
981940020 4:150271904-150271926 CCACAGCTGCCCCTTCCCCCAGG - Intronic
982926629 4:161345451-161345473 CTGTAACTTCCTCTTCCCACTGG - Intergenic
983596267 4:169471721-169471743 CCACAGCTGCCCCTTCCCCCAGG + Intronic
983867212 4:172782283-172782305 CCAAATCTTCCTTTTCTCAAAGG - Intronic
983928423 4:173427567-173427589 CAAAAGGTGCCTCTTCCCATAGG - Intergenic
984618698 4:181927567-181927589 CCACAGCTACCCCTTCCCCCAGG - Intergenic
984993024 4:185399752-185399774 CCAGCACTTCCTTTTCCCACTGG - Exonic
985969114 5:3361445-3361467 CCAAAGGTTTCTCTTTCCAGGGG + Intergenic
986445807 5:7820190-7820212 CCAAAGCTTCCCCTTTGCAATGG - Intronic
987019304 5:13852913-13852935 CCACAGCTGCCCCTTCCCCCAGG - Intronic
987370217 5:17186385-17186407 CCAAAGATTCCCCTTCCACCAGG + Intronic
988656441 5:33217090-33217112 CAAAAGCCTCCTCTGGCCACTGG - Intergenic
989084035 5:37656541-37656563 CCACAGCTGCCTCTTCCCTCAGG + Intronic
989088372 5:37700600-37700622 CAACAGATTCCTTTTCCCACTGG - Intronic
990224238 5:53631480-53631502 CCACAGCTGCCCCTTCCCCCAGG + Intronic
991025785 5:62027906-62027928 CCACAGTTGCCTCTTCCCCCAGG + Intergenic
991026623 5:62037243-62037265 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
991045893 5:62222135-62222157 CCAAAGGTCCCTCTTCTCAAGGG - Intergenic
992383796 5:76265048-76265070 CCAAAGCTGCCCTTTCCCCCAGG + Intronic
993255677 5:85587822-85587844 CCATAGCTGCCTCTTCCCCCAGG + Intergenic
993381810 5:87217463-87217485 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
993402735 5:87473119-87473141 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
993895034 5:93523393-93523415 CCACAGCTGCCACTTCCCCCAGG - Intergenic
994015084 5:94955810-94955832 CCACAGCTACCCCTTCCCCCAGG - Intronic
994142810 5:96360928-96360950 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
995162454 5:108997726-108997748 CCACAGCTGCCTCTTTCCCCAGG + Intronic
995252227 5:110006593-110006615 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
996209766 5:120793405-120793427 TCAAAGCTTTCTCTACCCACTGG - Intergenic
997004784 5:129804708-129804730 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
997584865 5:135038245-135038267 CCATAGCCTCCTCCTCCCAGCGG + Intronic
997902804 5:137783498-137783520 CCACAGCCACCTCTTCCCCCAGG - Intergenic
998752043 5:145333366-145333388 CCACAGCTTCCCCTTCCCCCAGG + Intergenic
999030021 5:148280879-148280901 CCACAGCTGCCCCTTCCCCCAGG + Intronic
999223430 5:150000533-150000555 CCACAGCTTCCTCCTCCGCCCGG + Exonic
999378607 5:151104357-151104379 CCAGAGCTGCCTCTGCCCCCAGG + Intronic
999608151 5:153339052-153339074 CCACAGCTGCCCCTTCCCTCAGG + Intergenic
999983976 5:156984987-156985009 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1000507175 5:162135777-162135799 ACCCTGCTTCCTCTTCCCACAGG - Intronic
1000582169 5:163048236-163048258 CCACAGCTTCCCATTCCCCCAGG + Intergenic
1000600300 5:163265860-163265882 CCAAAGCTTCCTGTATCCTCTGG - Intergenic
1000927852 5:167215538-167215560 CCAGAGTTTCCCCTTCCCACAGG - Intergenic
1001060756 5:168486676-168486698 TCAACCCTTCCTGTTCCCACAGG - Intronic
1001881610 5:175249579-175249601 GGACATCTTCCTCTTCCCACAGG - Intergenic
1002075787 5:176707714-176707736 GCAAAGGTTTCTCTTTCCACAGG - Intergenic
1002673580 5:180890242-180890264 CCACAGCCTCCCCTTCCCCCAGG - Intergenic
1002996167 6:2287070-2287092 CCACAGCCACCTCTTCCCCCAGG - Intergenic
1003169539 6:3710270-3710292 CCAACCCTTCCTCTGCCCACAGG + Intergenic
1003246423 6:4385914-4385936 CCTAAGCATCCTCTTCTCAGGGG + Intergenic
1003966278 6:11255566-11255588 CCCAAGCTTCCTTCTGCCACGGG - Intronic
1004944428 6:20596258-20596280 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1005795810 6:29360308-29360330 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1006117100 6:31781287-31781309 CCAGGGCTTCATCTTCCCAGAGG - Intronic
1006428345 6:33980059-33980081 CCAAGGCCTCCTCTCCACACAGG - Intergenic
1007024281 6:38553888-38553910 CCAGAACTTCCTGTTCCCAATGG - Intronic
1007195555 6:40056876-40056898 CCACAGCTACCCCTTCCCCCAGG + Intergenic
1007282096 6:40720369-40720391 CCCGAGCTTCCTCTTCCCCAGGG - Intergenic
1007499774 6:42287840-42287862 CCAATGCTCCCTCTGCCAACAGG + Intronic
1007663422 6:43500450-43500472 CCCAAGCTACCTCTCCCCAGGGG - Intronic
1008336691 6:50314670-50314692 CCACTGCTTTCTCCTCCCACAGG - Intergenic
1008758356 6:54824591-54824613 CCACAGCCTCCCCTTCCCCCAGG + Intergenic
1008865471 6:56204525-56204547 CCACAGCCTCCACTTCCCCCTGG - Intronic
1009709567 6:67300230-67300252 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1009718213 6:67428048-67428070 CCAAAGCTGCCCCTTCCCCCAGG + Intergenic
1010574990 6:77519067-77519089 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1011120136 6:83943006-83943028 CCATAGCTGCCCCTTCCCCCAGG - Intronic
1011209217 6:84936591-84936613 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1012127884 6:95453844-95453866 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1012343430 6:98156763-98156785 CCACAGCTGCCCCTCCCCACAGG + Intergenic
1012644366 6:101661072-101661094 CCACAGCTGCCCCTTCCCTCAGG + Intronic
1013200669 6:107892146-107892168 CCACAACTTCCCCTTCCCCCAGG + Intronic
1013341247 6:109218371-109218393 CCATCGCTTCCTCTTCCCCAGGG - Intergenic
1013716038 6:112962884-112962906 CCAAAACTTGCTCTTCTCTCAGG - Intergenic
1014070421 6:117175420-117175442 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1014223493 6:118822721-118822743 CCACAGCTTCCCCTTCCCCCAGG + Intronic
1014225257 6:118840017-118840039 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1014569092 6:122986735-122986757 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1014753743 6:125280760-125280782 CCACAGCTGCCCCTTCCCTCAGG - Intronic
1014836504 6:126166707-126166729 CCAGAGCTGCCCCTTCCCCCAGG + Intergenic
1014872584 6:126614641-126614663 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1015108961 6:129569508-129569530 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1015162967 6:130173791-130173813 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1015387018 6:132635670-132635692 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1015766541 6:136723984-136724006 ACACAGCTTCCTCCTCCCACAGG + Intronic
1015883235 6:137890987-137891009 CCATAGCTGCCCCTTCCCCCAGG + Intergenic
1016542211 6:145178490-145178512 CCACAGCTGCCCCTTCCCTCAGG - Intergenic
1017028727 6:150202541-150202563 CCGAAGCTTCTTCTGCCCAATGG - Intronic
1017683456 6:156887255-156887277 CCAATGCTGGCTCTTCCCACGGG + Intronic
1018013034 6:159689039-159689061 CCAAAGGCTCCCCTTCTCACTGG + Intronic
1018599177 6:165520847-165520869 AGAAAGCTTCCTTTTCTCACTGG - Intronic
1018639787 6:165895738-165895760 CCAAAACCTCCTGTTCCCAAGGG + Intronic
1019071859 6:169353469-169353491 CCAGAGCTGCCCCTTCCCCCAGG + Intergenic
1019432916 7:1007657-1007679 ACAAAGCAGCCCCTTCCCACAGG - Intronic
1020487620 7:8738719-8738741 CCACAGCTACCACTTCCCCCAGG + Intronic
1020629787 7:10625914-10625936 CCATAGCTGCCCCTTCCCCCAGG - Intergenic
1020694089 7:11392932-11392954 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1020935539 7:14459247-14459269 CCACAGCTACCCCTTCCCCCGGG - Intronic
1021014713 7:15518214-15518236 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1021071705 7:16249272-16249294 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1021377881 7:19931298-19931320 ATAAAGCTCCCTCTTCCCACAGG - Intergenic
1022112685 7:27241029-27241051 ACAAAGTTTCCTCTTCACTCCGG - Intergenic
1022354667 7:29601720-29601742 CCAAAGGTTTCTCATCCCAGTGG - Intergenic
1022884487 7:34628651-34628673 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1023269346 7:38444424-38444446 CCAAATTTTCCTCTTCTTACAGG - Intronic
1023780223 7:43648098-43648120 CCAGAGTTTCCTCATCCCAAGGG - Intronic
1025606698 7:63044664-63044686 CCAAAGTTACCACTCCCCACTGG - Intergenic
1026468494 7:70674699-70674721 GCTTAGCTCCCTCTTCCCACAGG - Intronic
1027273853 7:76539527-76539549 TCAAAGCATCCTCTTCCACCTGG + Intergenic
1028145831 7:87319111-87319133 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1028460998 7:91092404-91092426 CCTAGGCATCCTCTTACCACAGG + Intronic
1028523684 7:91759624-91759646 CCACAGCCTCCCCTTCCCCCAGG - Intronic
1028911449 7:96212339-96212361 ACTACCCTTCCTCTTCCCACAGG - Intronic
1028991306 7:97051456-97051478 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1028998319 7:97126412-97126434 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1029845205 7:103405774-103405796 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1030140987 7:106304082-106304104 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1030325799 7:108217515-108217537 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1030500769 7:110356378-110356400 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1030673626 7:112363608-112363630 CCACAGCTTCCCCTTCCCAGGGG + Intergenic
1030705589 7:112689761-112689783 CCACAGCCGCCTCTTCCCCCAGG + Intergenic
1031014989 7:116564123-116564145 ATGAAGCTTCCTGTTCCCACTGG + Intergenic
1031397694 7:121293116-121293138 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1032659695 7:133969940-133969962 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1032742434 7:134752253-134752275 CGAAAGCTTCCTTTTCTGACAGG - Intronic
1032883413 7:136114425-136114447 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1032921600 7:136555272-136555294 CCTAAGCTTTGTCTTCCCAACGG + Intergenic
1033617708 7:143032556-143032578 CCACAGCCTCCCCTTCCCCCAGG - Intergenic
1034274594 7:149818536-149818558 CCTGGGCTTGCTCTTCCCACAGG - Intergenic
1034689539 7:153003256-153003278 CCCACACTTCCTCATCCCACAGG + Intergenic
1034754742 7:153605874-153605896 CCAAAGCATCTTCTACCCTCAGG + Intergenic
1035794108 8:2337455-2337477 CCACAACTGCCTCTTCCCCCAGG - Intergenic
1035998557 8:4576265-4576287 ACAAGGCTTCCTCTTGCCACAGG + Intronic
1036098323 8:5749805-5749827 CCCCATCTTCCTCTACCCACTGG - Intergenic
1036156642 8:6348065-6348087 ACAGAGCCTCCTCTTCCCAAAGG - Intergenic
1036768617 8:11564228-11564250 GCGAAGCTGCCTCTGCCCACTGG - Exonic
1037881448 8:22575295-22575317 CCAAGGCCTCCTCTTCCCAGGGG + Exonic
1037915450 8:22770192-22770214 CCAGAGCTTCCTCTGCCCCAAGG - Intronic
1038426800 8:27469166-27469188 CCAAAGCTGACTTTTTCCACAGG - Intronic
1038694738 8:29796679-29796701 CCTGACCTTCCTCTGCCCACTGG + Intergenic
1038702389 8:29860972-29860994 TCAAAGCATCCTCATCCCATGGG - Intergenic
1041042513 8:53861947-53861969 CCAAAGCTTGGACTCCCCACGGG - Intronic
1041050857 8:53932673-53932695 CCATAGCTGCCCCTTCCCCCAGG - Intronic
1041079967 8:54206914-54206936 CCAAAGATGCCTCTTTCCCCAGG + Intergenic
1041156848 8:54996242-54996264 GCAAAGCCTCCTCTGCCCAGTGG - Intergenic
1042070763 8:64931016-64931038 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1042110977 8:65380489-65380511 CCACAGCCACCTCTTCCCCCAGG - Intergenic
1042267929 8:66927338-66927360 CCACAGCTTCCCCTTCACACTGG - Intergenic
1042349399 8:67761660-67761682 CCACAGCTGCCTCTTCCTCCAGG - Intergenic
1042812860 8:72845534-72845556 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1044445175 8:92266705-92266727 CCAGGGCTTGCTCTACCCACAGG + Intergenic
1044961062 8:97530721-97530743 CCACAGCTGCCACTTCCCCCAGG - Intergenic
1045185128 8:99830195-99830217 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1045797750 8:106065615-106065637 CCACAGCTGCCTCTTCCCCCAGG - Intergenic
1045975048 8:108122621-108122643 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1048052895 8:130836214-130836236 CCAACAATTCCACTTCCCACAGG + Intronic
1048467084 8:134674530-134674552 CCACAGCTGCCCCTTCCCACAGG - Intronic
1048875191 8:138831632-138831654 CCCAGGCATCCTCCTCCCACTGG - Intronic
1049526945 8:143131651-143131673 TTAAATATTCCTCTTCCCACTGG + Intergenic
1049964657 9:767286-767308 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1050141503 9:2521100-2521122 CCATAGCTGCCCCTTCCCCCAGG + Intergenic
1050239857 9:3623932-3623954 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1051124858 9:13792182-13792204 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1051308855 9:15747292-15747314 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1051863342 9:21651449-21651471 CCATAGCCGCCTCTTCCCCCAGG + Intergenic
1052134132 9:24889323-24889345 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1052667958 9:31518975-31518997 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1052850593 9:33376160-33376182 CCCAAGCCTGCTCCTCCCACAGG - Intergenic
1053394835 9:37764067-37764089 GCAAATATTCCTCTTCCCAAAGG - Intronic
1054764394 9:69031393-69031415 CCAAACTTTCATATTCCCACAGG - Intergenic
1054884874 9:70185494-70185516 CCACAGCTACCCCTTCCCCCAGG + Intronic
1054985937 9:71262100-71262122 CCACAGCTGCCCCTTCCCCCGGG + Intronic
1055390901 9:75821343-75821365 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1055571828 9:77624314-77624336 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1056302585 9:85257744-85257766 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1056385098 9:86090342-86090364 CCACAGCTACCCCTTCCCCCAGG + Intronic
1056453261 9:86736973-86736995 CCTATGTATCCTCTTCCCACAGG - Intergenic
1056870889 9:90277074-90277096 CCAGAGCTTCCTATTCTCAGAGG + Intergenic
1057839410 9:98473425-98473447 GGAAGGCTTCCTCTTCCCAGAGG + Intronic
1058029319 9:100177670-100177692 CCACAGCTGCCCCTTCCCTCAGG - Intronic
1058072823 9:100619207-100619229 CCAAAGCTGCCCCTTCCCCCAGG + Intergenic
1058259860 9:102814911-102814933 CCACAGCCGCCTCTTCCCCCAGG - Intergenic
1058344857 9:103948943-103948965 CCAAAGCTCCTTCTTCCAACAGG - Intergenic
1058408511 9:104704004-104704026 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1058841346 9:108912412-108912434 CACAATCTTGCTCTTCCCACAGG + Exonic
1059513404 9:114870252-114870274 CCACAGCTGCCTCTACCCCCAGG - Intergenic
1059954639 9:119502720-119502742 CCACAGCTGCCACTTCCCCCAGG - Intronic
1060595498 9:124845601-124845623 TCAAATCTACCTCTTCCCAGGGG - Intergenic
1060781616 9:126417146-126417168 CTAAAGCTTTCTCTGCCCAGGGG + Intronic
1060987189 9:127826516-127826538 CCAGAGCATCCTCCTCCGACTGG - Exonic
1061509959 9:131054360-131054382 CCCAAACTTCCTCTTTCCATGGG + Intronic
1185747214 X:2583305-2583327 CCAAGGCTTCGGCTTCCCAGGGG + Intergenic
1185775134 X:2797117-2797139 CCAAAGCTTCCTCTTCCCCGTGG - Intronic
1186774804 X:12854364-12854386 CCACAGCTGCCTTTTCCCCCAGG + Intergenic
1187027227 X:15448150-15448172 CAAAAGCTTCCTCTTGCCCAGGG - Intronic
1187839893 X:23476488-23476510 CCACAGCTGCCCCTTCCCACAGG + Intergenic
1188739222 X:33756590-33756612 CCAAAGATTTCCTTTCCCACTGG - Intergenic
1188921881 X:35987202-35987224 CCACAGCTGCCTCTTTCCCCAGG + Intronic
1189297935 X:39931937-39931959 CCCCAGCTTCCTCTGCTCACTGG + Intergenic
1189575052 X:42342967-42342989 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1190946091 X:55095509-55095531 CCACAGCTGCCCCTTCCCACAGG + Intronic
1191135314 X:57058187-57058209 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1191153084 X:57241984-57242006 CCACAGCCTCCCCTTCCCCCAGG - Intergenic
1191175098 X:57491130-57491152 CCACAGCTACCCCTTCCCCCAGG - Intergenic
1191194610 X:57707781-57707803 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1191208147 X:57855530-57855552 CCACAGCTGCCCCTTCCCTCAGG - Intergenic
1191785049 X:64908128-64908150 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1192228507 X:69246453-69246475 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1192703119 X:73497635-73497657 CCACAGCCACCTCTTCCCCCAGG + Intergenic
1192741069 X:73893076-73893098 CCACAGCTGCTCCTTCCCACAGG - Intergenic
1192937972 X:75881244-75881266 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1193003604 X:76591023-76591045 CCACAGCTGCCTCTTTCCCCAGG + Intergenic
1193068636 X:77283372-77283394 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1193113725 X:77755945-77755967 CCACAGCTGCACCTTCCCACAGG + Intronic
1194158586 X:90422968-90422990 CCACAGCCACCTCTTCCCCCAGG - Intergenic
1194229130 X:91300158-91300180 CCACAGCTGCCCCTTCCCTCAGG + Intergenic
1194315241 X:92369112-92369134 CCACAGCCTCCCCTTCCCTCAGG + Intronic
1194357371 X:92902049-92902071 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1194783083 X:98048950-98048972 CCACAGCTGCCTCTTCCCCCAGG + Intergenic
1194837420 X:98698707-98698729 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1194869482 X:99110693-99110715 TCAAAGCTTCCTCTTCTCATTGG + Intergenic
1194954368 X:100162192-100162214 CCACAGCCTCCCCTTCCCCCAGG + Intergenic
1195127385 X:101822141-101822163 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1195140151 X:101950724-101950746 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1195774770 X:108391291-108391313 CCACAGCTGCCCCTTCCCCCAGG + Intronic
1195820822 X:108943979-108944001 CCATAGCTACCCCTTCCCCCAGG + Intergenic
1196273117 X:113735601-113735623 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1196571326 X:117268892-117268914 CCACAGCTGCCCCTTCCCCCAGG - Intergenic
1196602897 X:117622682-117622704 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1196946544 X:120832657-120832679 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1197395546 X:125922929-125922951 CCAGAGCTGCCCCTTCCCCCAGG + Intergenic
1197880705 X:131164006-131164028 CCACAGCTGCCCCTTCCCCCAGG + Intergenic
1198062642 X:133062287-133062309 CCACAGCTGCCCCTTCCCCCAGG - Intronic
1198088884 X:133308084-133308106 CCAAAGCTGCCTCTAACCCCTGG + Intronic
1198295342 X:135282086-135282108 CCACAGCCACCTCTTCCCCCAGG + Intronic
1198645447 X:138801679-138801701 CCAAAGCCGCCCCTTCCCCCAGG + Intronic
1199975272 X:152891521-152891543 CCACAGCCGCTTCTTCCCACAGG - Intergenic
1200407659 Y:2829822-2829844 CCACAGCTACCCCTTCCCCCAGG - Intergenic
1200504902 Y:3999936-3999958 CCACAGCCACCTCTTCCCCCAGG - Intergenic
1200623292 Y:5480647-5480669 CCACAGCCTCCCCTTCCCTCAGG + Intronic
1201295229 Y:12456366-12456388 CCAAAGCTTCCTCTTCCCCGTGG + Intergenic
1201727801 Y:17172648-17172670 CCAAACTTACCTTTTCCCACTGG + Intergenic
1201848507 Y:18450831-18450853 CCATGGCTTCCTTTTCCCCCAGG + Intergenic
1201884809 Y:18869544-18869566 CCATGGCTTCCTTTTCCCCCAGG - Intergenic