ID: 914910750

View in Genome Browser
Species Human (GRCh38)
Location 1:151784142-151784164
Sequence ATTTAGGCACAGGTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914910750 Original CRISPR ATTTAGGCACAGGTGGAGGA AGG (reversed) Intronic
900482650 1:2906697-2906719 AGGAAGGCACAGGTGGAGCAGGG + Intergenic
900770946 1:4543619-4543641 ATACAGGCACAGGTGCAGGTAGG - Intergenic
901594110 1:10371207-10371229 AGAGAGGGACAGGTGGAGGAGGG - Exonic
903249642 1:22043451-22043473 ATGTGGGCATAAGTGGAGGAGGG + Intergenic
904250314 1:29218781-29218803 ATTTACACATAGCTGGAGGACGG + Intronic
905497063 1:38399509-38399531 AGTTGGGCACAGGAGGAGGGAGG + Intergenic
905824102 1:41016282-41016304 GTTTGGCCCCAGGTGGAGGACGG - Intronic
906063616 1:42964092-42964114 ATTTAAGCAGGGGTGGAGGGGGG - Intergenic
906538652 1:46567732-46567754 ATTTAGGCACTGGTGGTGTTGGG - Intronic
907471143 1:54674238-54674260 ATTAAGGCACTGGTGGGAGATGG + Intronic
907651207 1:56296424-56296446 ATTGAGGCTCAGATTGAGGAAGG - Intergenic
907880442 1:58545119-58545141 ATTTAGGAATGGGTGAAGGAGGG - Intronic
909335861 1:74473013-74473035 CTATAGGCACATGTGGAAGAAGG + Intronic
909774498 1:79467091-79467113 ATTTACCCACATGTGGAGGCAGG + Intergenic
911571991 1:99528502-99528524 ATTCACAAACAGGTGGAGGATGG - Intergenic
912534805 1:110359224-110359246 ATTTTGACGGAGGTGGAGGATGG + Intergenic
914910750 1:151784142-151784164 ATTTAGGCACAGGTGGAGGAAGG - Intronic
915245512 1:154553464-154553486 TTTTAGGAACAGTTGGAGCAGGG - Intronic
915864830 1:159487850-159487872 ATTTAGGAACAGGACGGGGATGG + Intergenic
915947140 1:160161625-160161647 ATTTTGGGCCGGGTGGAGGAGGG - Intronic
916448205 1:164893520-164893542 ATCTAGGCATAGGTGAAAGAGGG + Intronic
918445919 1:184616843-184616865 ATTTAGTCACAGGTAGTAGAGGG + Intronic
920100549 1:203514497-203514519 ATTTAGCCACAGGGGGAGAAAGG - Intergenic
920844330 1:209581115-209581137 AGCCAGGCACAGGAGGAGGATGG + Intergenic
921745157 1:218732060-218732082 ACTCAGGCACTGGTTGAGGAAGG - Intergenic
922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG + Intronic
922742338 1:228020988-228021010 TTTTGGGCACTGGTGGAGGTGGG - Intronic
923453112 1:234138359-234138381 ATTCTGGCAGAGGAGGAGGAGGG + Intronic
1063362690 10:5470529-5470551 CCTTAGGCACAGGCAGAGGAGGG - Intergenic
1063866044 10:10366831-10366853 AGTGAGGAGCAGGTGGAGGAAGG - Intergenic
1065747962 10:28859106-28859128 ATGGAGCCACAGGTGGATGAAGG - Intronic
1066447048 10:35492851-35492873 ATTTAGGGACAGGAGGATGTAGG + Intronic
1068667790 10:59695835-59695857 CTTTAGGTACATATGGAGGAAGG + Intronic
1068769428 10:60804370-60804392 GTTTAGGCACTGGTGGGAGAGGG + Intergenic
1072219613 10:93316358-93316380 ACTTGGGAACAGGTTGAGGAGGG + Intronic
1072298927 10:94040332-94040354 ATTTAGGCAGAAAGGGAGGAGGG - Intronic
1074195331 10:111179399-111179421 CATTAGGGACAGGTGGAGTAGGG + Intergenic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077287250 11:1773083-1773105 GTCCAGGCACAGGTGGGGGAGGG + Intergenic
1080307251 11:30850088-30850110 ATTTAAGCAGAGGTGTAGGCAGG - Intronic
1082772002 11:57214984-57215006 ATCTAGGCAGAGGAAGAGGAGGG - Intergenic
1083610763 11:64003116-64003138 TTCTGGCCACAGGTGGAGGAAGG - Intronic
1084920914 11:72469036-72469058 ATTTAGGGGAAGGTGAAGGAAGG + Intergenic
1089175804 11:116547972-116547994 AGGGAGGCACAGGTGGAGGGAGG - Intergenic
1091885644 12:4015337-4015359 ATTTAGGCGAAGGTGGGGGTCGG + Intergenic
1094136778 12:27136106-27136128 ATGAAGGAAGAGGTGGAGGATGG + Intergenic
1094186516 12:27648863-27648885 ATGAAGGGAGAGGTGGAGGATGG + Intronic
1094362849 12:29649017-29649039 ATGTGGGCAGAGGTGGAGGATGG - Intronic
1094787478 12:33865270-33865292 ATTTAGGCACAGATGGAACTTGG - Intergenic
1096182468 12:49558245-49558267 ATTTGGGGACAGGTAGAGGCAGG - Exonic
1096238380 12:49944983-49945005 GTTGAGGCCCAGGTGGAGGCAGG - Intergenic
1097300812 12:58016972-58016994 ATTTAGACACAGGTAAAGAAGGG + Intergenic
1097376248 12:58846441-58846463 ATTTGGGCATAGATGGAGGTAGG + Intergenic
1097674798 12:62588463-62588485 ATTTGGGGACAGGTGGAAAAGGG + Intronic
1097902027 12:64882833-64882855 ACATGGGCAGAGGTGGAGGAGGG - Intergenic
1097945892 12:65366958-65366980 CTTAAGGGACAGGAGGAGGAGGG + Intronic
1098029789 12:66242138-66242160 ATTTCAGCACAGGGGGAGGGTGG - Intronic
1099147350 12:79063553-79063575 ATTTACACATAAGTGGAGGAGGG + Intronic
1101340076 12:103835582-103835604 ATTTAGTAAGAGGTGGAGGTGGG - Intronic
1102119589 12:110429809-110429831 GTGTGGGCACAGGTGGAAGATGG + Intergenic
1108597461 13:51961771-51961793 AGTTGGGCCCAGGTAGAGGAAGG + Intronic
1111330613 13:86759426-86759448 AGTTAGGTATTGGTGGAGGAAGG + Intergenic
1114183445 14:20383361-20383383 ATTTGGGCAAAGGGGCAGGAAGG + Intronic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1115429602 14:33300927-33300949 ATTGAGGGCCAGGTAGAGGAAGG + Intronic
1116122227 14:40735640-40735662 ATTTTAGTACAGGTGGAGGCTGG + Intergenic
1117359812 14:54961612-54961634 ATCTAGCCAGTGGTGGAGGATGG - Intronic
1120376335 14:83712374-83712396 AATTAGGCATAGGTGGAAGATGG + Intergenic
1121904118 14:97724060-97724082 ATGTAGCCACAGCTCGAGGAAGG - Intergenic
1122237906 14:100343023-100343045 ATTTAGCCACATGTGGTGGCAGG - Intronic
1122319326 14:100844244-100844266 GATTAGGCACAGGTGGAGACAGG - Intergenic
1122330255 14:100907150-100907172 ATTGAAGCACAGGTGGTGGAAGG + Intergenic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1124639638 15:31389498-31389520 ATGTAAACACAGGGGGAGGAGGG - Intronic
1128450299 15:67802226-67802248 ACTAAAGCCCAGGTGGAGGAGGG + Intronic
1128700610 15:69801430-69801452 AGTTAGGGAGGGGTGGAGGATGG - Intergenic
1129665260 15:77576071-77576093 ACTGAGGCACAGGGAGAGGAGGG - Intergenic
1130298965 15:82665952-82665974 GTTGAGGCACTGCTGGAGGAGGG + Intronic
1130968000 15:88711323-88711345 AGTTTGGAAGAGGTGGAGGATGG + Intergenic
1132609565 16:808551-808573 ATTTAGGAAACTGTGGAGGACGG - Intronic
1132830520 16:1925797-1925819 ACGTGGGCACAGGTGGAGGGGGG + Intergenic
1133844982 16:9445125-9445147 ATTGAGGAACAGGTAGGGGAAGG + Intergenic
1134811463 16:17170542-17170564 CTCTAGGCAAAGGTGTAGGAAGG - Intronic
1135914080 16:26588249-26588271 ATTTATGCACACTTGGTGGAAGG - Intergenic
1139349191 16:66324804-66324826 CTTTAGGAAGAGGTGGAGGTGGG + Intergenic
1139797802 16:69497401-69497423 ATTTTGGGGGAGGTGGAGGAGGG - Intergenic
1140830370 16:78745301-78745323 TTGAAGGCAGAGGTGGAGGAAGG - Intronic
1142410088 16:89911523-89911545 ATCTGGGCACGGGTGGAGAAGGG + Intergenic
1142902869 17:3024130-3024152 ATTTAAGGGCAGGTGGAGAAGGG + Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284923 17:5781800-5781822 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284929 17:5781834-5781856 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284946 17:5781924-5781946 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143890354 17:10097893-10097915 AATTAGCCACAGGTGGTGGCAGG + Intronic
1148714234 17:49704358-49704380 ATTTGGTCACAGGTGGAAGGTGG + Intronic
1148804455 17:50257290-50257312 ACTGGGGCTCAGGTGGAGGAGGG + Intergenic
1151750186 17:76032746-76032768 CTCTAGGCCCAGCTGGAGGAGGG - Intergenic
1152451391 17:80383227-80383249 ACTTGGGGACAGGAGGAGGATGG - Intronic
1152966153 18:116141-116163 GATTAGGGAGAGGTGGAGGAAGG - Intergenic
1153501688 18:5756205-5756227 TTCTAGGCACAGGAGAAGGAGGG - Intergenic
1153664820 18:7359486-7359508 ATTTAGGGAGAGGTGGCTGAGGG - Intergenic
1154927819 18:20955925-20955947 GATTAGGGAGAGGTGGAGGAAGG + Intronic
1155201542 18:23522159-23522181 TTTCTGGCACAGTTGGAGGAAGG + Intronic
1155565543 18:27129994-27130016 AAGAAGGCAAAGGTGGAGGAGGG + Intronic
1156730140 18:40183904-40183926 ATTTAAACACATGTGGAGCATGG - Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1160824412 19:1073026-1073048 ACTGAGGCAGAGGTGGAAGACGG - Intronic
1161243157 19:3234158-3234180 ATGGAGGCCCAGGTAGAGGAGGG + Intronic
1161974891 19:7602919-7602941 ATTGAGGGAGAGGTGGAGGGGGG + Intronic
1162199270 19:9009143-9009165 ATTTACTCAGAGGAGGAGGAAGG - Intergenic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1163086265 19:14981865-14981887 ATTAAGGAACATGTGGAGCAGGG + Intronic
1165864074 19:38925407-38925429 AAGTGGGCCCAGGTGGAGGATGG + Intronic
1167854630 19:52227584-52227606 ATTTTGACCCAGGTGGTGGAAGG + Exonic
1168407967 19:56120712-56120734 GTTGAGGCCCAGGTGGGGGAAGG - Intronic
925254621 2:2472550-2472572 CTTTAGGCATGGGTGGAAGATGG - Intergenic
928915364 2:36464691-36464713 ATTTGTGCAGAGGAGGAGGAGGG + Intronic
929145911 2:38706928-38706950 ATTAAGGGTCAGGTGGAAGAAGG + Intronic
929172877 2:38948995-38949017 ATCCAGGCACAGGAGGTGGAGGG + Intronic
931007438 2:57867968-57867990 ATAAAGGCAAAAGTGGAGGAAGG + Intergenic
931058736 2:58502534-58502556 ATTAAGGCACTGGAGGAGGAAGG - Intergenic
932148755 2:69348751-69348773 ATTTTGGCAGAAATGGAGGATGG - Intronic
933058891 2:77710290-77710312 ATTTGGGTACAGATGGTGGAGGG - Intergenic
933350794 2:81149988-81150010 ATTTATGTACACGTGGAGGGTGG + Intergenic
933755185 2:85632883-85632905 TTTTAGGTAGAGGTGGAGGCAGG + Intronic
935013887 2:99161114-99161136 ATTTAGCCACACGTGGTGGCAGG + Intronic
936665943 2:114595622-114595644 ATATAGTCTGAGGTGGAGGATGG + Intronic
936870725 2:117132086-117132108 ATTTTGGGGCAGGTGGGGGAGGG - Intergenic
937025980 2:118697363-118697385 AGTGAGGCACAGGGGGAGGAAGG + Intergenic
938985547 2:136571912-136571934 ATTGAGGCTCAGGGAGAGGAAGG + Intergenic
939927904 2:148196914-148196936 ATTTTGGCACATGTGGATGGAGG - Intronic
942463538 2:176186385-176186407 ATCTAGCCAGAGGTGGAGGAGGG + Intergenic
942852438 2:180505028-180505050 ATTTAGAAAGAGGTGGAGGGTGG - Intergenic
946307006 2:218861724-218861746 ATTTAGACAGAGGGGGAGGGAGG - Intronic
946989908 2:225316868-225316890 GTTTGGGAAGAGGTGGAGGAGGG + Intergenic
947228617 2:227863453-227863475 AATTAGTCACAGTTGGAGGTAGG + Intergenic
948299147 2:236888899-236888921 ATTGAGGCTCAGGAGGAGGCAGG - Intergenic
948371932 2:237495142-237495164 ATGGAGGCACAGGTGAGGGAGGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169819573 20:9694537-9694559 ACTTGGGCACAGCTTGAGGAAGG - Intronic
1170699071 20:18687097-18687119 ATTCAGGCAGAGGAGAAGGATGG + Intronic
1173000326 20:39101086-39101108 ATTTGGGTACAATTGGAGGAGGG - Intergenic
1173408980 20:42793026-42793048 ATCTGGGCACAGTTGGAGGGTGG - Intronic
1174901973 20:54509820-54509842 TTTTCGGGACAGGTGGAGGCAGG - Intronic
1175099046 20:56565178-56565200 ATTAAGGCTCAGGAGGAGGGTGG + Intergenic
1175180201 20:57140971-57140993 ATTTAGCTAAAGGTGGAGCAAGG + Intergenic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1178449167 21:32677562-32677584 ATGTAGGCACAGGTGGAAAGAGG + Intronic
1183377289 22:37472590-37472612 ATCCTGGCACAGGTGGAGGAGGG + Intronic
1184403269 22:44286136-44286158 ATGTAGGCAAAGGTGGGGCAGGG - Intronic
949538490 3:5013765-5013787 AATGAGGCAGAGGAGGAGGAGGG - Intergenic
950105166 3:10384045-10384067 TTTCAGGCACAGGAGGAGGAAGG - Intronic
950233569 3:11297696-11297718 ATTTAGGCACTGTGGGAGGTGGG + Intronic
951053947 3:18125966-18125988 AATGAGGCAAAGGTGGAGGTGGG - Intronic
952228658 3:31405946-31405968 ATTTTGGGGCAGGTGGAAGAAGG - Intergenic
952363686 3:32655827-32655849 ATTTAGTCACTGTTGCAGGATGG - Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
954436122 3:50497269-50497291 ACTGAGGCCCAGGGGGAGGAGGG + Intronic
954634026 3:52061910-52061932 ATGAAGGCACATGTGGAGGCAGG - Intergenic
957042304 3:75345308-75345330 ATTTAGGGAAAGGAGGAGGCTGG - Intergenic
959463532 3:106655839-106655861 ATTTAGGATAAGGGGGAGGAAGG - Intergenic
959575922 3:107933630-107933652 ATCAAAGCAGAGGTGGAGGAAGG - Intergenic
960545472 3:118909581-118909603 ATTAAGGCATAGATGGAGAAGGG + Intronic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
961047032 3:123716158-123716180 ATTTAGGGAAAGGAGGAGGCTGG - Intronic
962855058 3:139337582-139337604 ATTTGGGAACAGCAGGAGGAAGG + Intronic
962882216 3:139588795-139588817 ATATAGGCACAGCTGAGGGAGGG + Intronic
963182381 3:142372422-142372444 AATTGGGCACAGGAAGAGGATGG + Intronic
963939321 3:151084768-151084790 ATTTAAGCAAAGGGGGAAGAAGG - Intergenic
964738987 3:159945728-159945750 ATTTAGCCACAAGTACAGGATGG - Intergenic
967157379 3:186705835-186705857 ATGTACTCACAGGTGTAGGAAGG - Intergenic
968755269 4:2412478-2412500 ACTGAGGCACAGGTGTGGGAGGG + Intronic
969991810 4:11272077-11272099 ATATAGGCACAGGGAGAAGATGG - Intergenic
971062136 4:22984194-22984216 AGTTAGGCAAAGGAGTAGGAGGG + Intergenic
973641891 4:52911329-52911351 ATTTAGTCAAAAGTGGAGCAAGG - Intronic
974583753 4:63841894-63841916 ATTAAGAAACAAGTGGAGGATGG - Intergenic
974603754 4:64122611-64122633 ATTTACGTACTGGTGGAGCAAGG + Intergenic
976725556 4:88212612-88212634 TTTTAGGCCCTGGTGGAGCAAGG - Intronic
976928040 4:90526555-90526577 ACATAGACACAGGTGGGGGATGG - Intronic
979474020 4:121133811-121133833 ATTTGGACACAGATGGAAGATGG + Intronic
979926780 4:126577449-126577471 ATTCAGGAAGAGGTGGAGAAGGG - Intergenic
980130734 4:128813185-128813207 ATTTAATCACAGGTGGAGAAAGG + Intronic
980267504 4:130536800-130536822 ATTTAGGCACAGGAGTAAGTTGG - Intergenic
980709963 4:136552930-136552952 ATTTAGGCACTGGGAGAGGCAGG - Intergenic
980910379 4:138988771-138988793 ATTTGGGCAGAGGGGTAGGAGGG - Intergenic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
982750036 4:159149941-159149963 AAACAGGCACAGGTGGAGGTTGG + Intronic
984631912 4:182070135-182070157 GTGGAGGCACAGGTGGGGGAAGG + Intergenic
988141861 5:27253542-27253564 ATTTATTCACAACTGGAGGAAGG - Intergenic
988566949 5:32327017-32327039 ATTTAGTAACTGGTGGAGGCAGG - Intergenic
995433401 5:112107954-112107976 GTTTTGGCAGAGGTAGAGGAAGG - Intergenic
996923551 5:128796773-128796795 AACTAGGCACAGGTGGAGAAGGG - Intronic
998371076 5:141661862-141661884 TTTTAGGCACAAATGCAGGATGG + Intronic
999763871 5:154723508-154723530 GTATAGGCAAAGGTGGAGAAAGG + Intronic
1000833461 5:166130184-166130206 AATTAGGCGTTGGTGGAGGAAGG + Intergenic
1001268141 5:170290121-170290143 CTTTTGGAAAAGGTGGAGGAGGG - Intronic
1001327608 5:170740643-170740665 TTTTAGGAATAGGTGGAGAATGG - Intergenic
1001814226 5:174654533-174654555 ATTTTGGCACATGTGGAGATGGG - Intergenic
1006481836 6:34301304-34301326 ATGTAGGGAGAGGTGGAGAATGG - Intronic
1007027223 6:38588450-38588472 GATTAGGCCCAGTTGGAGGAGGG - Intronic
1008452195 6:51665923-51665945 GTGTAAGCACAGGTGGAGGTGGG + Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1010472260 6:76242504-76242526 ATCTAGGGTCAGGTGGAGGAGGG + Intergenic
1016012956 6:139157814-139157836 GGCGAGGCACAGGTGGAGGAGGG + Intronic
1016343785 6:143089059-143089081 AATTAGCCACAGGTGGTGGTGGG + Intronic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1019862189 7:3669588-3669610 GTTTAAAGACAGGTGGAGGAAGG - Intronic
1019888221 7:3924038-3924060 ATTTAGGAAGAGGTGCAGAATGG + Intronic
1023356299 7:39370600-39370622 ATTTAGGCAGAGGTGGGGAGGGG - Intronic
1024678102 7:51656114-51656136 ATCGAGGTCCAGGTGGAGGAAGG + Intergenic
1026805713 7:73428908-73428930 ATGAAGGCACAGGTGCAGCATGG + Intergenic
1029967430 7:104754766-104754788 ATTAAGGAACAGGAGGAGCATGG + Intronic
1031963149 7:128007604-128007626 TTTTAGGCAAAGATGGAAGAAGG + Intronic
1033029898 7:137815942-137815964 ATTTAGGGACAGGTTGATGATGG - Intronic
1034744723 7:153513698-153513720 ACTTAGGGATAGTTGGAGGATGG + Intergenic
1035430689 7:158818515-158818537 ATTTCAGCAGAGGTGGGGGAGGG + Intronic
1036683066 8:10890082-10890104 ATTTAGGGACAGTTCCAGGAGGG + Intergenic
1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG + Intergenic
1038054054 8:23841420-23841442 ATTTAGAAAGAGTTGGAGGAGGG - Intergenic
1038760179 8:30378654-30378676 CTTTGGGATCAGGTGGAGGATGG - Intergenic
1038914380 8:32004216-32004238 ATTCAGGGACTGGTTGAGGATGG + Intronic
1038974666 8:32680526-32680548 ATTTAGCCATAGGTGGCTGAAGG + Intronic
1039264099 8:35805891-35805913 ATTCAGGCAGTGGTGGAAGATGG + Intergenic
1041780167 8:61569103-61569125 ATACAGGCACAGGTAGAGGATGG + Intronic
1043623512 8:82227440-82227462 GCTCAGGCTCAGGTGGAGGATGG - Intergenic
1043954378 8:86343249-86343271 TGTTAGGGAAAGGTGGAGGAAGG - Intronic
1045448074 8:102288250-102288272 ATTTAGGTTGAGGTGGTGGAGGG - Exonic
1045730930 8:105239850-105239872 ATTCAGGAAGATGTGGAGGAAGG - Intronic
1048940684 8:139398011-139398033 AATTAGGCAGAGGTTGAAGATGG - Intergenic
1049415270 8:142492154-142492176 ATTAAAGAACAGGTGGACGAAGG - Intronic
1049765994 8:144355473-144355495 AATTGGGCAAAGGTGGAGGGTGG + Exonic
1050752035 9:8950378-8950400 ATTTAGGAACATATGGAGAAGGG + Intronic
1051607172 9:18927408-18927430 CTTTAGTCACAGGTGATGGAGGG - Intergenic
1053158295 9:35795229-35795251 ATAAAGGCACAGGGGCAGGAAGG - Intronic
1055079163 9:72250783-72250805 ATTAAGGAAATGGTGGAGGATGG - Exonic
1056943833 9:90977195-90977217 ATTCAGGGGCAGGGGGAGGAAGG + Intergenic
1057259234 9:93575198-93575220 ATTTTGGCTCAGTAGGAGGAAGG + Intergenic
1057398447 9:94701255-94701277 ATACAGGGCCAGGTGGAGGATGG - Intergenic
1060172708 9:121474893-121474915 ATTAAGGCTCAAGCGGAGGACGG - Intergenic
1061759657 9:132841660-132841682 ACTGAGGCCCAGATGGAGGAAGG - Intronic
1061906680 9:133702713-133702735 ATCTCGGCACAGAGGGAGGAGGG + Intronic
1062076693 9:134593580-134593602 CTCCAGGCGCAGGTGGAGGATGG - Intergenic
1185491194 X:518242-518264 ATACAGGCTGAGGTGGAGGATGG - Intergenic
1186107905 X:6226667-6226689 GTTGAGGGACAGGAGGAGGAAGG + Intronic
1190817422 X:53940342-53940364 GTTTAGGCTCAGGAGGAGGCAGG + Exonic
1191669107 X:63732525-63732547 ATTAAGGCATAGCTTGAGGAAGG - Intronic
1192236359 X:69298676-69298698 ACTAAGGCCCAGGGGGAGGAAGG + Intergenic
1192331282 X:70177335-70177357 AATTGGGCACACGTGGAGAAAGG + Intergenic
1193189105 X:78548572-78548594 AAGAAGGCACAGGAGGAGGAGGG - Intergenic
1194427426 X:93756812-93756834 ATTTAGGTTCAGGTGGAGGTGGG + Intergenic
1194894371 X:99421467-99421489 ATTTAGCTGGAGGTGGAGGAGGG + Intergenic
1195920747 X:109981165-109981187 TTATAGGCACAGGTGCAGGCAGG + Intergenic
1197970496 X:132110241-132110263 TTTAAGGGATAGGTGGAGGAGGG + Intronic
1199551428 X:149065801-149065823 ATTCAAGCACAGGTTGGGGATGG + Intergenic