ID: 914912661

View in Genome Browser
Species Human (GRCh38)
Location 1:151800087-151800109
Sequence GTGAGGAAAGTGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 911
Summary {0: 1, 1: 0, 2: 8, 3: 82, 4: 820}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914912653_914912661 5 Left 914912653 1:151800059-151800081 CCGGGCATGGAGGTGGGGGTGCA 0: 1
1: 0
2: 7
3: 77
4: 738
Right 914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG 0: 1
1: 0
2: 8
3: 82
4: 820
914912642_914912661 29 Left 914912642 1:151800035-151800057 CCGGGGCTAGGAGTGCTGATCCC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG 0: 1
1: 0
2: 8
3: 82
4: 820
914912652_914912661 8 Left 914912652 1:151800056-151800078 CCTCCGGGCATGGAGGTGGGGGT 0: 1
1: 0
2: 2
3: 38
4: 1007
Right 914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG 0: 1
1: 0
2: 8
3: 82
4: 820
914912650_914912661 9 Left 914912650 1:151800055-151800077 CCCTCCGGGCATGGAGGTGGGGG 0: 1
1: 0
2: 4
3: 31
4: 480
Right 914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG 0: 1
1: 0
2: 8
3: 82
4: 820

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914912661 Original CRISPR GTGAGGAAAGTGAAGGTGGG AGG Intergenic
900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG + Intronic
900479357 1:2890564-2890586 GACAGGAGAGTGAGGGTGGGCGG - Intergenic
900581228 1:3410637-3410659 GTGCGGAGAGGGGAGGTGGGAGG + Intronic
900625688 1:3607567-3607589 GTGAGGATGGAGAAGGTGGCAGG + Intronic
900860369 1:5224726-5224748 GTGAGGAAAGCAAAGGGGGCAGG + Intergenic
900914587 1:5627122-5627144 GTGAGGGAAGGGAATGTGGGAGG + Intergenic
900975170 1:6012150-6012172 GTGATGAAGGTGGAGGTGGTGGG + Intronic
900975220 1:6012340-6012362 GTGATGAAGGCGGAGGTGGGTGG + Intronic
900975257 1:6012483-6012505 GTGATGAAGGCGGAGGTGGGTGG + Intronic
901226137 1:7613913-7613935 GGGAGGAGAGAGATGGTGGGGGG + Intronic
901286183 1:8080637-8080659 GTGAGAAAAGTGATCGTGGCAGG + Intergenic
901651140 1:10743843-10743865 TTGAGGAAAGGGAGGGAGGGAGG + Intronic
901806353 1:11741069-11741091 GTGAGGGGAGTGGAGGAGGGAGG - Intronic
902283006 1:15388242-15388264 GGGAGGGAAGGGAAGGAGGGAGG - Intronic
902283024 1:15388287-15388309 GGGAGGGAAGGGAAGGAGGGAGG - Intronic
903434675 1:23338146-23338168 TGGAGGAAAATGTAGGTGGGAGG - Intronic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
904465861 1:30707221-30707243 GAGAGTGATGTGAAGGTGGGTGG - Intergenic
904533907 1:31186683-31186705 GGGAGGAAAGTGATGGAGTGAGG - Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905104633 1:35557281-35557303 GTGAGGGGAGCGAAGGTTGGGGG - Exonic
905142910 1:35862772-35862794 CTTTGGAAAGTCAAGGTGGGTGG + Intergenic
905273615 1:36802860-36802882 GTGAGGAAAGGGAAGCCTGGAGG - Intronic
905348831 1:37330472-37330494 GTGAGGAAACTGAAGCTCAGAGG + Intergenic
905894020 1:41533723-41533745 GTGAGAAGAGTGCAGGTCGGAGG - Intronic
906286162 1:44589161-44589183 CTGGGGAAAGTGAAGTTTGGTGG - Intronic
906581877 1:46941530-46941552 GTGGGGAGAGTGAAGGAGGAGGG + Intergenic
906601839 1:47137367-47137389 GTGGGGAGAGTGAAGGGGGAGGG - Intergenic
906637316 1:47417789-47417811 GACAGGTAAGTGGAGGTGGGGGG - Exonic
906714497 1:47956702-47956724 GTGAGGAAGCTGAAACTGGGTGG + Intronic
906812439 1:48842178-48842200 GTGAGGAAAGTGCAGGCTGATGG - Intronic
907267165 1:53269609-53269631 GTAAAGAAGGTGAAGGGGGGTGG - Intronic
907336908 1:53705719-53705741 GGGAGGAAAGGGAAGAAGGGAGG + Intronic
907661149 1:56393516-56393538 GTGAGGAAAGTGATGCTCAGAGG - Intergenic
907953121 1:59203072-59203094 GTGAGTAAAGTGAAGTTCAGAGG - Intergenic
908066994 1:60416736-60416758 ATGAGGAAAGAGAAGGGAGGTGG + Intergenic
908511706 1:64854802-64854824 GGAAGGAAGGTGAAGGTGGAAGG - Intronic
908704077 1:66931034-66931056 GCCTGGAAAGTGAAGGTGGTGGG - Intronic
909121847 1:71613138-71613160 GCAAGGCAAATGAAGGTGGGTGG + Intronic
909336042 1:74475214-74475236 TTGAGGAAATTAAAGGAGGGAGG + Intronic
909520973 1:76567035-76567057 ATGAGGACAGGGAAGGAGGGAGG + Intronic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
911094375 1:94043982-94044004 GGAAGGAAAGGGAAGGAGGGAGG - Intronic
911380342 1:97106408-97106430 CTGAGTAAAGAGAATGTGGGCGG + Intronic
911735121 1:101328625-101328647 GTGATGAAAGTGAAGGACTGAGG - Intergenic
912254140 1:108041925-108041947 GTGAGAAAATAGAGGGTGGGAGG + Intergenic
912308513 1:108595569-108595591 GGGAGGAAAGGGAGGGTGGGAGG + Intronic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
912719888 1:112011341-112011363 GGGAGGACAGTGAAGGAGGTGGG - Intergenic
913099044 1:115546206-115546228 GTGAGGAATGTGGAGCAGGGAGG - Intergenic
913185441 1:116366540-116366562 GTAATGAAAGTGATGGTAGGAGG - Intergenic
913686269 1:121234971-121234993 GTGAAGGAAGTGAGGGAGGGAGG - Intronic
913702053 1:121383291-121383313 GAAAGGAAAGTGAGGGAGGGGGG + Intronic
914038120 1:144022593-144022615 GTGAAGGAAGTGATGGAGGGAGG - Intergenic
914042612 1:144063760-144063782 GAAAGGAAAGTGAGGGAGGGGGG + Intergenic
914135475 1:144896728-144896750 GAAAGGAAAGTGAGGGAGGGGGG - Intronic
914151334 1:145045347-145045369 GTGAAGGAAGTGAGGGAGGGAGG + Intronic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
915068259 1:153244315-153244337 GTGAGGATAGTGGTGGTGGTGGG + Intergenic
915310877 1:155005237-155005259 GTGGGGACAGTGAAGGCTGGGGG + Intronic
915316038 1:155029751-155029773 GCGAGGGAAGTCAAGTTGGGAGG - Intronic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
915537770 1:156547843-156547865 GTGAGGAAACTGAGGGAGAGAGG + Intronic
915835697 1:159173087-159173109 GTGGGGAGAGTGAAGGGGGAGGG + Intronic
916100335 1:161388807-161388829 GTGAGGAAACTGCAGGAGGCTGG - Intergenic
916148674 1:161764604-161764626 GGGAGGAAAATGAAGCAGGGAGG + Intergenic
916179931 1:162074495-162074517 ATGAGGAAATTGAAGTTTGGAGG + Intronic
916258771 1:162819478-162819500 CTGATGGAAGTGATGGTGGGAGG + Intergenic
916452100 1:164930539-164930561 GGGAAGAAAGAGAAGGAGGGAGG - Intergenic
916578013 1:166084387-166084409 ATGAGGAAACTGAAGGTGAAAGG - Intronic
916822172 1:168410198-168410220 GGGAGGAAGGGGAAGGTAGGTGG + Intergenic
916941083 1:169679225-169679247 TTTAGTAAAGAGAAGGTGGGTGG - Intronic
917105303 1:171485736-171485758 GTAAGGAAAGCGAGGGTGTGGGG + Intronic
917380090 1:174396893-174396915 GTTTGGAAGGTGGAGGTGGGAGG + Intronic
917429658 1:174952831-174952853 CTGTGGGAAGTCAAGGTGGGTGG - Intronic
917716698 1:177745589-177745611 GTGAGGAAAGGGAGGGTGGCTGG - Intergenic
918406343 1:184214913-184214935 TAGAGGAAAGTGAGGATGGGAGG - Intergenic
918523414 1:185439541-185439563 GAGAGGATAGAGAAGGTGGGGGG + Intergenic
918760696 1:188401785-188401807 GTGGGGAAAGGGAGGGTGAGGGG + Intergenic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
920347966 1:205318839-205318861 CTGAGGGAAGGGCAGGTGGGCGG - Intronic
920349660 1:205329453-205329475 GTAGGGGAAGTGAAGTTGGGAGG + Intergenic
920473591 1:206253518-206253540 GTGAAGGAAGTGAGGGAGGGAGG - Intronic
920489475 1:206402011-206402033 GAAAGGAAAGTGAGGGAGGGGGG + Intronic
920552193 1:206871840-206871862 ATGAGGAAATTGAAGATGAGAGG + Intergenic
920767238 1:208845215-208845237 ATGAGGAAATAGAAGGTGGCAGG - Intergenic
920975276 1:210780042-210780064 TTGAGAAAGCTGAAGGTGGGTGG + Intronic
921179652 1:212621990-212622012 TAGAGGAAAGGGAAGGTGGGGGG + Intergenic
921315763 1:213888596-213888618 GAGGGGAGAGAGAAGGTGGGAGG + Intergenic
921585038 1:216936152-216936174 GTCAGGAATGTGAAGGTTGGGGG + Intronic
921627384 1:217392058-217392080 GTGAGGACAGTGAAGGGGGGGGG - Intergenic
922300947 1:224300244-224300266 TTGAGGAAAGTAAAAGTGAGTGG + Intronic
922440726 1:225653234-225653256 GGGAGGAAAGGGGAGGCGGGGGG + Intergenic
922896020 1:229101065-229101087 GGGAGGAAAGTGAATCTGGCAGG - Intergenic
923512294 1:234662996-234663018 GTGAGGTAAGTGAGTGAGGGGGG - Intergenic
923743254 1:236675400-236675422 GTGAAAAAAGTACAGGTGGGTGG - Intergenic
1062995132 10:1858482-1858504 GTGAGAAAACTGAGGCTGGGAGG + Intergenic
1063025932 10:2178809-2178831 GGAAGGAAAGGGAAGGAGGGAGG - Intergenic
1063143276 10:3274562-3274584 GTGAGGAATGTGATGGGGTGGGG + Intergenic
1063386203 10:5617673-5617695 GTGAGGACAGTGAAGGGCCGCGG + Intergenic
1063516689 10:6703281-6703303 CTTTGGGAAGTGAAGGTGGGAGG - Intergenic
1063578582 10:7284306-7284328 GGGAGGAAAGGGAAGGGGTGGGG - Intronic
1063664623 10:8053900-8053922 GTGAGGGATGAGAAGGGGGGAGG - Intronic
1063768380 10:9169168-9169190 GTGGGGAAAGGGAAAGTGGGAGG + Intergenic
1064405562 10:15059152-15059174 GGGAGGAAAGGGAAGGGGAGAGG - Intronic
1064836843 10:19542320-19542342 GTAAGGAAAATAAAGATGGGTGG - Intronic
1064870718 10:19933853-19933875 GGAAGGAAAGGGAGGGTGGGAGG + Intronic
1064877749 10:20014341-20014363 GGAAGGAAAGGGAAGGAGGGAGG - Intronic
1065797608 10:29321760-29321782 GTGGGGGAAGTGGGGGTGGGAGG - Intergenic
1065800668 10:29348958-29348980 GCGAGGAAAGTGAAGGCTGCTGG - Intergenic
1065955918 10:30693357-30693379 GTGAGGGGAGTGGCGGTGGGAGG + Intergenic
1066099888 10:32108300-32108322 ATGAGCAAAATGCAGGTGGGTGG + Intergenic
1066334580 10:34463041-34463063 GGGAGGAAAGGGAAGGGGGAGGG + Intronic
1068434398 10:56972129-56972151 GTCAGGAGAGTAAAAGTGGGGGG + Intergenic
1068667755 10:59695577-59695599 GTGGGGAGAGTGGATGTGGGTGG - Intronic
1069079886 10:64077417-64077439 GTGGGGACAGTGGTGGTGGGGGG + Intergenic
1069079912 10:64077489-64077511 GTGGGGACAGTGGTGGTGGGGGG + Intergenic
1069079926 10:64077527-64077549 GTGGGGACAGTGGTGGTGGGGGG + Intergenic
1069637760 10:69936062-69936084 GTGAGGGAAGGGAGGGAGGGAGG + Intronic
1069824466 10:71246584-71246606 GGGAGGGAAGTGAGGGAGGGAGG + Intronic
1070085719 10:73235354-73235376 TTGGGGAAAGAAAAGGTGGGGGG + Intronic
1070953376 10:80448555-80448577 GAGTGGGAAGGGAAGGTGGGAGG - Intergenic
1071119222 10:82258762-82258784 ATGAGGAATGTGAAGGTTGGAGG + Intronic
1071297432 10:84232486-84232508 GTGAGGTCTGTGAAGGTGGTGGG - Exonic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1071668079 10:87579678-87579700 CTGAAGAAAGTGAACGTGGTAGG + Intergenic
1072302705 10:94076982-94077004 GTGAGGGAACTGTGGGTGGGAGG - Intronic
1072533805 10:96344246-96344268 GTGTTGAAAGTAAAGATGGGGGG - Exonic
1072730075 10:97840305-97840327 GTTAGGAAAGGGAGGGAGGGAGG + Intergenic
1073570037 10:104573263-104573285 GTGAGGAAAGTAGGGGTAGGAGG + Intergenic
1075201474 10:120408329-120408351 TTGTTGAAAGTGAAGGTGTGAGG - Intergenic
1075485116 10:122815435-122815457 AGGAGGAAAGCGAAGGAGGGAGG - Intergenic
1075661575 10:124200561-124200583 GGGAGGAAAGAGAAGGAGGTAGG + Intergenic
1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG + Intergenic
1076485363 10:130812090-130812112 GTGAGGAGACTGCAGGTGGAGGG + Intergenic
1076719775 10:132388007-132388029 GTGAGAAACGTGAATGTGGTTGG + Intergenic
1076855959 10:133115753-133115775 TTGAGGACAGTGAGGGTTGGAGG - Intronic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077382459 11:2250497-2250519 CTGGGGAAAGTGAAGGTCAGAGG + Intergenic
1077524612 11:3056881-3056903 GTGAGGAAACTGAGGCTGGGTGG + Intronic
1077801531 11:5543686-5543708 GTGAGGAGAGGGAATGAGGGTGG - Intronic
1077958640 11:7049002-7049024 GTGAGGGGAGTGAGGGTGGAGGG + Intronic
1078060319 11:8039086-8039108 TTGAGGTCAGTGAGGGTGGGTGG - Intronic
1078100537 11:8327936-8327958 GTGGGGAAAGGGAAGGGGAGTGG + Intergenic
1078664995 11:13316759-13316781 ATGGGGAAAGTGGATGTGGGAGG + Intronic
1079029684 11:16977285-16977307 GTTTGGAAAGGGAAGGAGGGAGG - Intronic
1079164450 11:18026066-18026088 TGGAGGAAAGTGTAGGTGGGTGG - Intronic
1079648362 11:22895436-22895458 GTGAGGAAGGTCAAGGGGTGAGG - Intergenic
1081020081 11:37935194-37935216 ATGAGGAAAGTGAAAGTCAGAGG + Intergenic
1081492001 11:43576548-43576570 GGGAGGAAAGAGAAAGTGGATGG - Intronic
1081611680 11:44566602-44566624 GTGAGGAAACTGAAGTTTGGAGG - Intronic
1081694074 11:45097493-45097515 GTGAGGAAATTGAAGCTCAGGGG + Intronic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083266974 11:61551272-61551294 GTGGGGGAAGTGAAAGTGTGTGG + Intronic
1083533548 11:63447691-63447713 GTGAAGGAAGTGAAGGTGTCAGG - Intergenic
1083552181 11:63598227-63598249 GTGAGGAAGGTGCAGCTGAGTGG + Intronic
1083753495 11:64777031-64777053 GTGAGGGGAGTGGAGGTGGGTGG - Intronic
1084295501 11:68211245-68211267 GTGGGGAAGGTGGAGGTGGATGG - Intronic
1084772580 11:71353318-71353340 GGGAGGAAAATGAAGGAGGTTGG - Intergenic
1085178052 11:74507829-74507851 GTGAGGAAGGTGAAGGAAGTGGG - Intronic
1085188128 11:74593323-74593345 ATGAGGAAATTGAAGCTGAGGGG + Intronic
1085228138 11:74941204-74941226 GTGAGGAAACTGAAGTTCAGAGG - Intronic
1085759377 11:79228518-79228540 GTGAGGTCTGAGAAGGTGGGTGG - Intronic
1086070112 11:82790626-82790648 CTGATGGAAGTGAAGGTGTGAGG + Intergenic
1087185449 11:95187910-95187932 GTGAGGATGGAGAAAGTGGGTGG - Intronic
1088942393 11:114472871-114472893 GTTTGGGAAATGAAGGTGGGGGG + Intergenic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089299634 11:117490824-117490846 CTGGGGAGAGTGAAGGTGAGTGG + Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089612496 11:119677331-119677353 GAGAGGGAAGTGTGGGTGGGAGG + Intronic
1089623427 11:119736038-119736060 GGGAGGAAAGTGTGGGTGGGAGG - Intergenic
1090623550 11:128584849-128584871 GGGAGGAAAGGGAAGGAGGAGGG + Intronic
1090867428 11:130714015-130714037 GTGAGGAAATGGAATGTGAGAGG - Intronic
1091077983 11:132639182-132639204 GTGAGGAAAGAGCAGGCGGGTGG + Intronic
1091282930 11:134392122-134392144 GTGAGGAAAGTGTAGCTCAGTGG + Exonic
1091362387 11:134987721-134987743 GGGAGGAAGGTGGAGGAGGGAGG + Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092194649 12:6541913-6541935 GTGAGGAAAGTCAGTGTGGGCGG + Intronic
1093057539 12:14569705-14569727 GTTAGTAAGGTGAAGGAGGGTGG - Intergenic
1096647925 12:53048292-53048314 GTGAGACCAGTGAAGGTGAGAGG + Intronic
1099440019 12:82687469-82687491 GAGGGAAAAGTGAAGCTGGGAGG + Exonic
1099619604 12:84984469-84984491 CTCAGGAAGCTGAAGGTGGGAGG - Intergenic
1099650122 12:85415906-85415928 CTGAGGAAAATCAAGGTGGAAGG + Intergenic
1099782481 12:87215314-87215336 CTGAGTTAAGTGAGGGTGGGAGG - Intergenic
1100332563 12:93598325-93598347 GGGTAGAAGGTGAAGGTGGGAGG + Intergenic
1100490341 12:95072840-95072862 GAGAGAAAAGTGAAAGTGGGGGG + Intronic
1100678789 12:96896743-96896765 GTCAGCTATGTGAAGGTGGGAGG + Intergenic
1101044037 12:100786337-100786359 GTGAGGTAGGAAAAGGTGGGGGG + Intronic
1101259458 12:103013586-103013608 GTGAGGAGAATGAAGTGGGGCGG + Intergenic
1101681932 12:106976883-106976905 ATGAGGAAACTGAAGCTGAGAGG - Intronic
1101882626 12:108635847-108635869 ATGAGGAAACTGAAGCTGAGAGG + Intergenic
1101945475 12:109133005-109133027 GTGTGGAGAGAGAAGGTGAGTGG - Intronic
1102394222 12:112574121-112574143 GTAGTGAAAGTGAAGGAGGGAGG + Intronic
1102582181 12:113896659-113896681 GTGAGGAGAGGGAAGGCGGGAGG + Intronic
1102651939 12:114448396-114448418 GGGAGGGAAGTGAAAGTGTGAGG - Intergenic
1102724986 12:115054621-115054643 GGGAGTGAAGTTAAGGTGGGTGG - Intergenic
1102753880 12:115320991-115321013 GTGGGGAAGGCAAAGGTGGGAGG + Intergenic
1102903922 12:116660423-116660445 GAACTGAAAGTGAAGGTGGGGGG - Intergenic
1102977226 12:117215325-117215347 CTGTGGAAAGAGAAGTTGGGGGG + Intronic
1103017286 12:117505273-117505295 TTGAGCACACTGAAGGTGGGTGG + Intronic
1103153890 12:118666970-118666992 ATGAGGAAACTGAAGCTTGGTGG + Intergenic
1103224148 12:119272403-119272425 GTTAGGAAGGTTAAGTTGGGAGG - Intergenic
1103940090 12:124496653-124496675 GGGAGGAAGGTTAAGGTTGGGGG + Intronic
1104448096 12:128848945-128848967 GTGGGGAAAATGGAGGGGGGTGG - Intergenic
1104709532 12:130975926-130975948 GGGAGGAAGGTGAAGCTGAGGGG - Intronic
1104962541 12:132495118-132495140 GTGGGGAATGTGAGGGTGTGAGG + Intronic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105205324 13:18218436-18218458 GTTTGGAAGGTGGAGGTGGGCGG - Intergenic
1105239487 13:18597442-18597464 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1106188781 13:27432089-27432111 TTGAGGAACGTGAGGGTGGCTGG + Intronic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1106647437 13:31651480-31651502 GTGAGGCAAGGCAAGGTGTGAGG - Intergenic
1107637673 13:42409044-42409066 GAGAAGACACTGAAGGTGGGAGG - Intergenic
1108165980 13:47693530-47693552 ATGAGGAAAGAGAGGGAGGGAGG - Intergenic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1108596153 13:51951364-51951386 GTGAGGGAAGAGAAGGGGAGGGG + Intronic
1110306021 13:73987699-73987721 GAGAGGAGAGAGAAAGTGGGGGG + Intronic
1110306043 13:73987791-73987813 GAGAGGAGAGAGAAAGTGGGGGG + Intronic
1111359245 13:87153001-87153023 GTGGGGAATGGGAAGGGGGGAGG + Intergenic
1111753834 13:92367857-92367879 ATGAGGACGGTGCAGGTGGGTGG + Intronic
1111893001 13:94106520-94106542 GTGAGGGAAGTGAGGGAGGATGG + Intronic
1111985298 13:95059925-95059947 ATGAGGAAACTGAAGCTTGGAGG + Intronic
1111989396 13:95102041-95102063 GTGAGGAAAGAGAAGGTAAGCGG + Intronic
1112015742 13:95330065-95330087 GGGAGGAAAGAGGAGGTGAGGGG + Intergenic
1112986656 13:105458273-105458295 GTGAGGAAGGGGGAGCTGGGGGG - Intergenic
1113104434 13:106757803-106757825 GGGAGGGAGGTGAGGGTGGGTGG + Intergenic
1113406520 13:110045969-110045991 GTGATGCAGGAGAAGGTGGGAGG - Intergenic
1113552088 13:111200375-111200397 GAGAGAAAGGTGAAGGTGAGTGG - Intronic
1113814108 13:113159737-113159759 GTCAGGAAAGTGGAGGAGGGAGG - Intronic
1114326153 14:21590785-21590807 CTGTGGAAAGTCAAGATGGGTGG + Intergenic
1114737013 14:25051853-25051875 ATGAGGAAAGTGAAGCTTAGAGG - Intergenic
1115072786 14:29346088-29346110 CTCAGAAAAGTGATGGTGGGAGG - Intergenic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1115652588 14:35413692-35413714 GTGGGGACAGTGAAGATGGAAGG - Intergenic
1116475094 14:45331009-45331031 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
1117616412 14:57538007-57538029 GTGAGAAAAGTGAAGCTGACAGG - Intergenic
1118467777 14:66046373-66046395 GTGAAGAAAGGGAAGGAAGGAGG - Intergenic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119686113 14:76632672-76632694 CTGAGGAGAGGGAAGGTTGGAGG + Intergenic
1119884376 14:78128120-78128142 ATGAGGAAAGTGAGGCTCGGTGG + Intergenic
1120698056 14:87666404-87666426 ATGAGGAAAGTGAAGCTCAGAGG + Intergenic
1120922958 14:89771870-89771892 GTGAAGACAGTGCTGGTGGGGGG - Intergenic
1121098398 14:91233628-91233650 GTGAGGACATGGAGGGTGGGAGG - Exonic
1121104958 14:91273659-91273681 GAGAAGAGAGTGAAGGTTGGAGG + Intronic
1121434046 14:93907096-93907118 GTGAGGAAACTGAGGCTGAGAGG - Intergenic
1121456698 14:94043095-94043117 GTGAGGAGGGAGAAGGTGGTGGG - Intronic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122327311 14:100890481-100890503 GTGAGGACAGGGGAGGAGGGTGG + Intergenic
1122363272 14:101180015-101180037 GTGTGGCCAGTGGAGGTGGGTGG - Intergenic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1122581224 14:102772980-102773002 GTGATGACAGGGAAGGTGAGAGG - Intergenic
1122688071 14:103519334-103519356 GTAGGGATAGTGGAGGTGGGGGG - Intergenic
1122893565 14:104744177-104744199 GTGGGGAAAGTGCACGTGTGGGG + Intronic
1123058607 14:105584245-105584267 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123082938 14:105704479-105704501 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1202835425 14_GL000009v2_random:74546-74568 GAGTGAAAGGTGAAGGTGGGGGG + Intergenic
1123548259 15:21355735-21355757 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1124106167 15:26740137-26740159 GTGAGGATGGGGATGGTGGGGGG - Intronic
1124139853 15:27067628-27067650 GTCAGGAAAGGGAAGGGGAGTGG - Intronic
1124382412 15:29177754-29177776 GTGAGGCAAGTCAAGGGTGGCGG + Intronic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1124641834 15:31400696-31400718 GTGTGGAAGGTGGAGGAGGGTGG + Intronic
1124645741 15:31436559-31436581 GTGAGGCAAGGGTGGGTGGGAGG + Intergenic
1126561548 15:50049291-50049313 GTGAGGAGAGTGAAAGGGTGGGG - Intronic
1127358831 15:58226938-58226960 GTGTGGAGAGTGAGGGTTGGGGG + Intronic
1127378443 15:58406758-58406780 GTGGGGATAGTGAGGGTGGAGGG - Intronic
1127499209 15:59541240-59541262 GGGAGGGAAGGGAAGGAGGGAGG - Intergenic
1127555320 15:60081973-60081995 GAGAGGGAAGTGGAGATGGGTGG + Intergenic
1127761705 15:62146180-62146202 GTGAGGGTAGGGAAGGAGGGTGG - Intergenic
1128907207 15:71477761-71477783 GTGAATAAAGTGACGGTGTGAGG - Intronic
1128927818 15:71674753-71674775 GTGAGGGCAGAGAAGGGGGGAGG + Intronic
1129120697 15:73394690-73394712 GGGAGGGAAGAAAAGGTGGGAGG - Intergenic
1129298453 15:74612429-74612451 GTGAGGAGGGTGATGGTGAGGGG - Intronic
1129786785 15:78314958-78314980 CTTTGGAAAGTCAAGGTGGGAGG - Intergenic
1130148624 15:81294166-81294188 GGGGTGAAAGTGAAGGAGGGAGG + Intronic
1130242181 15:82204716-82204738 AGGAGGAAAGAGTAGGTGGGCGG - Intronic
1130458192 15:84136106-84136128 AGGAGGAAAGAGTAGGTGGGCGG + Intergenic
1130993379 15:88890046-88890068 GGAAGGAAAGGGAAGGAGGGAGG + Intronic
1131035441 15:89218912-89218934 GAGAAGAGAGGGAAGGTGGGTGG + Intronic
1131189964 15:90306712-90306734 ATTATGAAAGTGATGGTGGGAGG + Intronic
1131789551 15:95949227-95949249 AGGAGGAAAGTGAAGGTGCATGG + Intergenic
1131870504 15:96758623-96758645 TTGGGGAAAGAAAAGGTGGGGGG + Intergenic
1132203308 15:99969785-99969807 GGGAGGTCAGTGATGGTGGGAGG + Intergenic
1202956591 15_KI270727v1_random:82965-82987 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1132974601 16:2705073-2705095 GTCAGGACAGTGCGGGTGGGCGG - Intronic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133087433 16:3375854-3375876 AGGAGGAAAGGGAAGGAGGGAGG - Intronic
1133412359 16:5579307-5579329 GACTGGAAAGTGAAGGTGGGTGG - Intergenic
1133809282 16:9148765-9148787 TTGGGGAAAGTAATGGTGGGAGG + Intergenic
1134898629 16:17913822-17913844 GGGAAGTATGTGAAGGTGGGAGG + Intergenic
1135009549 16:18862650-18862672 GTGAAGAGACTGGAGGTGGGGGG - Intronic
1135376764 16:21953798-21953820 GCGGATAAAGTGAAGGTGGGGGG - Intronic
1135539035 16:23315959-23315981 GTGAGGATGGTGATGGTGAGAGG - Intronic
1135627288 16:24007134-24007156 ATGAGGAAACTGAAGCAGGGAGG - Intronic
1135957136 16:26965263-26965285 CTTTGGAAAGTCAAGGTGGGAGG + Intergenic
1136063794 16:27745341-27745363 GTGAGGAAAGTGAGGGGAAGTGG - Intronic
1136313255 16:29430280-29430302 GTGAAGAGACTGGAGGTGGGGGG - Intergenic
1136381330 16:29897249-29897271 GTGGGGAAGGGAAAGGTGGGGGG - Intronic
1137384727 16:48030733-48030755 GTGGGGAAGGTGTATGTGGGTGG + Intergenic
1137396477 16:48119053-48119075 GGGAGGAAATTGAAGGTGGGAGG - Intronic
1138102012 16:54259757-54259779 GAAAGGAAGGTGGAGGTGGGAGG + Intronic
1138174388 16:54883438-54883460 GGAAGGAAAGGGAAGGAGGGAGG + Intergenic
1138231723 16:55342448-55342470 CTGTGGAAAGCCAAGGTGGGAGG + Intergenic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1138524295 16:57592986-57593008 GTGAGCAGAGTGGCGGTGGGAGG + Intergenic
1138621281 16:58213123-58213145 GGAAGGAAAGGAAAGGTGGGAGG + Intergenic
1138703187 16:58886527-58886549 GTTTGGGAAGTCAAGGTGGGAGG + Intergenic
1139616451 16:68097107-68097129 GTAAGGAAAGGGAAGGAGGCAGG + Intronic
1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG + Intronic
1139966814 16:70750365-70750387 GGGAGGAAAGAGAGGGAGGGAGG + Intronic
1141248042 16:82329182-82329204 GTTGGGAAAATGATGGTGGGAGG - Intergenic
1141557582 16:84846210-84846232 GGGAGGGAAGGGAAGGAGGGAGG - Intronic
1141647628 16:85376082-85376104 GTGAGGACCGTGAGGGTTGGGGG - Intergenic
1142064474 16:88053254-88053276 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064497 16:88053374-88053396 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064537 16:88053620-88053642 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064576 16:88053854-88053876 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064597 16:88053968-88053990 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064637 16:88054214-88054236 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142199748 16:88755468-88755490 GGGAGGAATGTGCAGGTGGCTGG - Intronic
1142218480 16:88841465-88841487 TTGAGGAAAGGGAAGGACGGGGG - Intronic
1142332370 16:89462932-89462954 GGGAGGGAGGTGGAGGTGGGGGG + Intronic
1142785161 17:2215840-2215862 GGGAGGGGAGTGAGGGTGGGTGG + Intronic
1142847916 17:2691018-2691040 GGGAGGAAAGCGGAGTTGGGGGG + Intronic
1142986920 17:3700994-3701016 GTGAGGGAGGAGAAGGAGGGGGG - Intergenic
1143153888 17:4823518-4823540 GAGAGGAGAGTGGAGGAGGGTGG - Intergenic
1143470813 17:7174068-7174090 CTGAGGAGAGAGAAGGCGGGTGG + Intronic
1143579746 17:7818583-7818605 ATGAGGAAGGTGAAGGTCGAAGG + Intronic
1143585264 17:7847668-7847690 GTGAGGAAGGTCCAGGTGGCAGG - Exonic
1143779662 17:9222580-9222602 GTGAGGAAAGAGGAGGAGGGAGG + Intronic
1144469645 17:15526383-15526405 GTGAGGAAACTGAGGATTGGGGG - Intronic
1144521094 17:15952759-15952781 CCGAGGAAGGTGCAGGTGGGAGG - Intronic
1144716615 17:17440592-17440614 GTGAGGAAAGTGCAGGGTGAGGG - Intergenic
1144873216 17:18382972-18382994 GTGGGGAGAGAGAAAGTGGGGGG - Intronic
1144926706 17:18817270-18817292 GTGAGGAAACTGAGGATTGGGGG + Intergenic
1144931832 17:18865279-18865301 TTGAGGAAAATGAAGATGAGAGG + Intronic
1145766821 17:27463946-27463968 GTGAGGAAACTGAAGGCCTGAGG + Intronic
1146674344 17:34762967-34762989 GTGGGGGCAGTGAAGGTGGGTGG - Intergenic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147970259 17:44215626-44215648 GGGAGGAGAGTTAAGGTGGGAGG - Intronic
1148249758 17:46066201-46066223 GTGATAACAGTGAAGGTGAGAGG + Intronic
1148469224 17:47883253-47883275 GTGGGGAGAGGTAAGGTGGGCGG - Intergenic
1148496806 17:48057896-48057918 GTGAGGAAATTGAAGCTCAGAGG + Intronic
1148535835 17:48437995-48438017 GTGGGGAAATTGGATGTGGGAGG - Intergenic
1148638241 17:49165552-49165574 GTGAGGGGAGAGAAGGAGGGTGG - Intronic
1148790243 17:50168684-50168706 GTGAGGGGTGTGAAGCTGGGAGG - Intronic
1148869722 17:50649678-50649700 GGGAGGGAAGGGAAGGAGGGAGG + Intronic
1149454513 17:56777116-56777138 GTCAGGGCAGAGAAGGTGGGTGG - Intergenic
1149573846 17:57697307-57697329 GTGAGTAAAGTGAGTGTGAGTGG - Intergenic
1150293168 17:63993279-63993301 GGGAGGGAAGGGAAGGAGGGAGG + Intergenic
1150293186 17:63993332-63993354 GGGAGGGAAGGGAAGGAGGGAGG + Intergenic
1150293197 17:63993357-63993379 GGGAGGGAAGGGAAGGTGGGAGG + Intergenic
1150293206 17:63993378-63993400 GGGAGGGAAGGGAAGGAGGGAGG + Intergenic
1150293213 17:63993395-63993417 GGGAGGGAAGGGAAGGTGGGAGG + Intergenic
1150293241 17:63993465-63993487 GGGAGGGAAGGGAAGGAGGGAGG + Intergenic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150689314 17:67350778-67350800 GTGAGGAAACTGAAGGCATGAGG - Intronic
1151624459 17:75267914-75267936 GAGAGGAAGGTGAAGGGTGGGGG + Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151833896 17:76570930-76570952 AAGAGGAAAGTGATGGTGTGTGG + Intronic
1151873991 17:76856265-76856287 GTGAGGAAACTGAGGCTTGGAGG + Intergenic
1152681133 17:81668608-81668630 GTGAGGAAGGTGCAGGGAGGAGG + Intronic
1153797419 18:8637018-8637040 CTTTGGAAAGTCAAGGTGGGAGG + Intronic
1154032624 18:10766972-10766994 GGGAGGGAATGGAAGGTGGGAGG - Intronic
1154098444 18:11444172-11444194 GTGGGGAGAGGGAAGGGGGGAGG - Intergenic
1154130550 18:11733389-11733411 GTGAGGCCAGTGAGGCTGGGGGG + Intronic
1154131850 18:11743885-11743907 GTGAGGCAAGGGTAGGTGTGGGG - Intronic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1154449308 18:14461179-14461201 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1154493100 18:14936352-14936374 GGGAGGAAGGTGGAGGAGGGAGG - Intergenic
1154518161 18:15197206-15197228 GTGAGGAAACTGAAGGCCTGAGG - Intergenic
1155225421 18:23725516-23725538 GAGAGGGGAGTGGAGGTGGGTGG + Intronic
1155381192 18:25224514-25224536 GAGGGGAAAGGCAAGGTGGGGGG - Exonic
1155559846 18:27063872-27063894 GTGGGGGTGGTGAAGGTGGGAGG + Intronic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156478602 18:37422105-37422127 GTGAGGAAACTGAATGTGGTGGG + Intronic
1156620748 18:38848532-38848554 GGAAGGAAATTGAAGGTGTGTGG - Intergenic
1157612715 18:48968433-48968455 GAGAGGGAAGGGAAGGAGGGAGG + Intergenic
1158414172 18:57234660-57234682 ATGAGGAAAAGAAAGGTGGGAGG + Intergenic
1158435774 18:57435127-57435149 GGGAGGGAGGAGAAGGTGGGGGG - Intergenic
1158558539 18:58494819-58494841 GACAGGAAAGTCCAGGTGGGAGG - Intronic
1159023284 18:63160695-63160717 GGGAGGAATGTGATGGTTGGAGG - Intronic
1159247687 18:65830593-65830615 GGAAGGAAAGGGAAGGGGGGAGG - Intronic
1159736874 18:72111012-72111034 TAGAAGAAAGTGAAGGAGGGAGG + Intergenic
1159738694 18:72137072-72137094 ATGATGGAAGTGAAGGTTGGAGG + Intergenic
1159931397 18:74316017-74316039 GGGAGGAAAGGGCGGGTGGGCGG - Exonic
1160123631 18:76151451-76151473 ATGGGGAAAGGGAAGGTGTGAGG - Intergenic
1161026425 19:2039346-2039368 GTGAGCAGAGGGTAGGTGGGTGG - Exonic
1161167393 19:2795657-2795679 CTCTGGAAAGTGGAGGTGGGAGG - Intronic
1161170920 19:2812185-2812207 GTGAGGAAACTGGAGGTTGGAGG - Intronic
1161286453 19:3471008-3471030 GTGAGGAGAGGGATGGAGGGAGG + Intergenic
1161363341 19:3863862-3863884 ATGAGGAAAGTGAGGCTTGGGGG - Intronic
1161519660 19:4716731-4716753 GTGGGGAAACTGAAGCTGGGAGG + Intronic
1162251665 19:9449723-9449745 CTTTGGAAAGTCAAGGTGGGTGG + Intergenic
1162332952 19:10041567-10041589 ATGAGGAAACTGAGGCTGGGAGG - Intergenic
1162826539 19:13255792-13255814 AAAAGGAAAGTGAAGGAGGGAGG - Intronic
1163351183 19:16777493-16777515 GGGAGGAAAGGGAAGGGGAGGGG + Intronic
1163358207 19:16828810-16828832 GATAGGGAAGTGAAGATGGGAGG + Intergenic
1163401740 19:17098052-17098074 GTGAAGAAAAAAAAGGTGGGGGG - Intronic
1164521193 19:28981635-28981657 GGGAGGAAGGTGAAGGAGGCGGG + Intergenic
1164693105 19:30225671-30225693 GTAAGGAAAACAAAGGTGGGGGG + Intergenic
1165156996 19:33795367-33795389 GGGAGGAAGGTGAAGTGGGGGGG - Intergenic
1165302130 19:34976947-34976969 GGGAAGAAAGTGGAGGAGGGTGG - Intergenic
1166010100 19:39935319-39935341 GTGTGGGCAGTGAGGGTGGGAGG + Intergenic
1166303187 19:41923606-41923628 GAAATGAAAGTGAGGGTGGGTGG + Intronic
1166519233 19:43468749-43468771 GTGAGGGAAGAGGAAGTGGGAGG + Intergenic
1166540514 19:43602323-43602345 GGGAGGGAGGTGGAGGTGGGAGG - Intronic
1166767899 19:45263273-45263295 CAGAGGAGAGTGAGGGTGGGTGG - Intronic
1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG + Intronic
1166930760 19:46299802-46299824 GTGAGGAAGCAGACGGTGGGGGG + Intronic
1167213099 19:48145941-48145963 GTGAGAAAAGTAAAGCGGGGAGG - Intronic
1167737732 19:51306951-51306973 GTTAGGAAAGTGAGGGTTGGTGG - Intergenic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1168068824 19:53937561-53937583 GGGAGGGAAGGGAAGGGGGGAGG - Intronic
1168406455 19:56112926-56112948 GAGAAGAGAGTGAGGGTGGGAGG - Intronic
1168663321 19:58183898-58183920 CTGAGGAAACCGAAGTTGGGAGG - Intronic
1202669974 1_KI270709v1_random:40934-40956 GTGAGGAAACCGAAGGTCTGAGG + Intergenic
925056865 2:863070-863092 GGAAGGAAAGAGAAGGTGGAGGG - Intergenic
925186482 2:1850132-1850154 GGAAGGAAAGGGAAGGAGGGAGG - Intronic
925587016 2:5474765-5474787 GTGAGGCAGGTGGATGTGGGCGG - Intergenic
925587059 2:5474914-5474936 GTGGGGCAGGTGAATGTGGGTGG - Intergenic
925600832 2:5607294-5607316 AGGAGGAAAGTGAGGGTTGGTGG + Intergenic
926059065 2:9794000-9794022 GTGAGGAGAGTGAGGCTGAGGGG - Intergenic
926385922 2:12335784-12335806 AGGAGGAAAGTGAAGGGAGGGGG - Intergenic
926773951 2:16403862-16403884 GGGTGGAAAGAGAAGGTGGATGG - Intergenic
926913715 2:17874275-17874297 GTGAGGAAAGTGCAGAGGAGAGG + Intergenic
926958896 2:18332531-18332553 GTGAGGGAAGCCAAGGAGGGGGG - Intronic
927278440 2:21281822-21281844 GTGGAGAAAGGGAAGGTTGGAGG + Intergenic
927645739 2:24875673-24875695 GTGAGGAAACTGAGGCCGGGAGG - Intronic
927680304 2:25134631-25134653 GGGAGGGAAGGGAAGGTGTGAGG - Intronic
927860196 2:26555939-26555961 ATGAGGAAACTGAGGGTGAGTGG + Intronic
928342662 2:30458632-30458654 GAGTGGAGAGTGATGGTGGGTGG + Intronic
928389154 2:30895769-30895791 GCAGGGAAAGAGAAGGTGGGAGG - Intergenic
928400517 2:30974889-30974911 GAGGGATAAGTGAAGGTGGGAGG + Intronic
928589133 2:32795820-32795842 GTTTGGAAGGTCAAGGTGGGTGG - Intronic
929670321 2:43872129-43872151 GTGTGGAAAGGTAAGGTGGCAGG + Exonic
929831700 2:45352113-45352135 ATGAGGCAAGGGAAGGCGGGAGG + Intergenic
930826374 2:55700413-55700435 AGGAAGAAAGGGAAGGTGGGAGG - Intergenic
931077693 2:58734988-58735010 GAGAGGAGAGAGAAGGAGGGAGG - Intergenic
931094751 2:58926668-58926690 GGGAGGAAGGAGAATGTGGGTGG - Intergenic
931152814 2:59593969-59593991 GTGGGGAAATGGAAGGTGGAGGG + Intergenic
931287769 2:60847090-60847112 GTCAGAAAGGTGTAGGTGGGTGG - Intergenic
931757667 2:65388528-65388550 GTGAGTACAGTGAGGGTGGCTGG + Intronic
932210085 2:69920506-69920528 GTAAGGAGAGTGAATGTGGGGGG - Intronic
932501941 2:72190137-72190159 CTCAGGGAGGTGAAGGTGGGAGG - Intronic
933665624 2:84962243-84962265 CTCAGGAGAGTGAGGGTGGGAGG + Intergenic
933920229 2:87038633-87038655 GGAAGTGAAGTGAAGGTGGGGGG + Intergenic
933931395 2:87155153-87155175 GGAAGTGAAGTGAAGGTGGGGGG - Intergenic
934002768 2:87731260-87731282 GGAAGTGAAGTGAAGGTGGGGGG - Intergenic
934555857 2:95286723-95286745 GGGAGGAAAGTGGAGGGGAGTGG - Intronic
936037644 2:109125586-109125608 TTCATGAAAGTTAAGGTGGGGGG - Intergenic
936076523 2:109405007-109405029 GTAGGGGAAGAGAAGGTGGGGGG - Intronic
936361724 2:111810286-111810308 GGAAGTGAAGTGAAGGTGGGGGG + Intronic
936945911 2:117930542-117930564 ATGAGGAAACTGAGGCTGGGAGG + Intronic
936946307 2:117934061-117934083 GTGAAGAGAGTGAAGGGGTGAGG + Intronic
937040957 2:118820294-118820316 CAGAGGAAAGTGAGTGTGGGAGG + Intergenic
937278594 2:120702303-120702325 GAGAGGGGAGTGAGGGTGGGAGG + Intergenic
937307483 2:120881379-120881401 GTGGGGAGAGGGCAGGTGGGGGG + Intronic
937503466 2:122509556-122509578 ATGAGAAAAGTGGAGCTGGGTGG - Intergenic
938307394 2:130265122-130265144 GTGAGGACAGTGCAGGTGTCGGG + Intergenic
938447940 2:131391720-131391742 GTGAGGACAGTGCAGGTGTCGGG - Intergenic
938463941 2:131514823-131514845 GGGAGGAAAGTGAAGCCGTGGGG + Intergenic
938856095 2:135312770-135312792 GTTTGGAAAGCCAAGGTGGGTGG + Intronic
941415915 2:165221323-165221345 GTGAGGAAAGGAAAGGAGTGAGG - Intergenic
941675942 2:168343772-168343794 GGGTGGAAAGTGAAGGGTGGAGG + Intergenic
941949285 2:171136474-171136496 CTGAGGCAAGTGAACCTGGGAGG + Intronic
942257749 2:174122526-174122548 GTGAGGCAAGTCAAAGTGAGTGG + Intronic
942482350 2:176402979-176403001 GGAAGGAAAGGGAAGGAGGGAGG - Intergenic
944014624 2:195020271-195020293 TTGAGGATGGTGAGGGTGGGGGG + Intergenic
944805955 2:203281398-203281420 GTAAGGAAGGCTAAGGTGGGAGG + Intronic
945057457 2:205881180-205881202 GGGAGGAAAGGGAGGGAGGGAGG + Intergenic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945396557 2:209325317-209325339 GGGAGCTAAGTGAAGATGGGAGG - Intergenic
945768528 2:214010868-214010890 GTGAGTAAAAAGAAAGTGGGAGG + Intronic
945810461 2:214543673-214543695 GAGAGGAAAATGAAGATGGCTGG + Intronic
946013371 2:216584425-216584447 GTGAGGAGCATGAAGGTGGTAGG - Intergenic
947154343 2:227146380-227146402 GTGAAAGAAGTGAAGGTGGTGGG - Intronic
947232674 2:227903647-227903669 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232682 2:227903664-227903686 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232690 2:227903681-227903703 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947331670 2:229035451-229035473 GTGAGTAGAGGGAAGGAGGGGGG - Intronic
947429348 2:230012107-230012129 GGTAGGAAAGTGAAGGTTGCAGG - Exonic
947658784 2:231851057-231851079 ATGAGGAAACTGAAGGTTAGAGG + Intergenic
948138941 2:235658953-235658975 GGGAGGAAAGAGGAGGAGGGAGG - Intronic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
948676707 2:239601192-239601214 GTGAGGAAACTGAGGCTGGTAGG - Intergenic
948735062 2:239998229-239998251 AGGAGGAAAGTGAAGGAGGGAGG - Intronic
948904333 2:240971130-240971152 GTGAGGCACGTGGAGATGGGGGG - Intronic
948935056 2:241158535-241158557 CTGAAGAAAGTGAAGGTGAGAGG + Exonic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1169014468 20:2280352-2280374 GTGGGGGAAGTGAAGCTGGAAGG - Intergenic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172302218 20:33858136-33858158 GGGAGGAAAGGGAAGGAGGAAGG + Intergenic
1172325247 20:34029471-34029493 GGGAGGAAAGGGAGGGAGGGAGG + Intronic
1172384825 20:34526601-34526623 GTGAGGACACTGGAGGTGGCTGG - Intronic
1172963225 20:38813454-38813476 CTGATGGAAGGGAAGGTGGGAGG + Intronic
1173174298 20:40752753-40752775 GGGAGGAAGGTTAAGGTGGGAGG - Intergenic
1173271618 20:41541614-41541636 GTGAGATAAGTGAAGTTGGTGGG + Intronic
1173294885 20:41747777-41747799 GAGAGGGCAGGGAAGGTGGGGGG + Intergenic
1174423503 20:50416126-50416148 GAGAGGAAAGTGGAGGTGCTGGG + Intergenic
1174607188 20:51769155-51769177 GTGAGGATGGTGAAGGTCAGAGG - Intergenic
1174735585 20:52962730-52962752 GTAAAGAAAGGGAAGGTGGCTGG - Intergenic
1174863999 20:54118010-54118032 GTGTTGCAAGTGATGGTGGGGGG + Intergenic
1174875492 20:54222801-54222823 GTGGGGAAAATGCAGGTGGGAGG + Intronic
1175066152 20:56290630-56290652 GTGTGGTCAGTGTAGGTGGGGGG - Intergenic
1175186052 20:57180278-57180300 GGGAGGGGAGTGAGGGTGGGCGG - Intronic
1175317299 20:58057931-58057953 GTGAGGAAATTGAATCTGAGAGG - Intergenic
1175806047 20:61829936-61829958 GTGTGGGAAGTGCAGGTGGGTGG + Intronic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1176049831 20:63112889-63112911 GTGAGTAAAGTCCAAGTGGGGGG - Intergenic
1176446864 21:6829200-6829222 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1176825035 21:13694226-13694248 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1177467701 21:21510339-21510361 GTGAGGGAGGTTAATGTGGGTGG - Intronic
1178714826 21:34954675-34954697 GTGAGGGGAGAGAGGGTGGGTGG - Intronic
1180008569 21:45034770-45034792 GTGCAGAAGGTGGAGGTGGGAGG + Intergenic
1180022570 21:45137738-45137760 GTGAGGAAAGTGGGGATGGAAGG + Intronic
1180033367 21:45227869-45227891 GTGAGGATAGTGCAGTGGGGCGG + Intergenic
1180068637 21:45425157-45425179 GTGAGGAAGGAGGCGGTGGGTGG - Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186122 21:46140212-46140234 GTGAGGCACGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180687059 22:17677486-17677508 GTGAGGGAGGCCAAGGTGGGCGG + Intronic
1180756946 22:18168907-18168929 ATGAGGGAAGTGGAGGTAGGAGG - Intronic
1180760651 22:18200285-18200307 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1180770965 22:18384582-18384604 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1180775017 22:18424411-18424433 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1180808092 22:18735466-18735488 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1181071016 22:20340431-20340453 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1181074825 22:20368535-20368557 ATGAGGGAAGTGGAGGTAGGAGG + Intronic
1181194088 22:21169380-21169402 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1181215354 22:21323398-21323420 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1181308279 22:21929249-21929271 GGCAGGAAAGGGGAGGTGGGGGG + Intronic
1181359446 22:22323391-22323413 GTGAGGAGAGTGATGGGAGGAGG - Intergenic
1181369532 22:22405134-22405156 GTGAGGAGAGTGATGGGAGGAGG - Intergenic
1181876817 22:25946048-25946070 GGGAGGGGAGGGAAGGTGGGAGG - Intronic
1182004215 22:26945667-26945689 GTGATGCAAGTGAAAGTGAGGGG + Intergenic
1182310581 22:29402800-29402822 CTGAGAAAAGTGCAGGGGGGCGG - Intronic
1182690469 22:32157946-32157968 CTGAGAAAAGTGCAGGGGGGCGG + Intronic
1182756972 22:32688209-32688231 ATGAGGAAACTGAAGGTCAGGGG + Intronic
1183080528 22:35452965-35452987 ATGAGGAAACTGAGGCTGGGAGG + Intergenic
1183228007 22:36563482-36563504 TTGAGGAAAGGGAAGGAGAGGGG - Intergenic
1183645627 22:39124365-39124387 GGGAGGGCAGTGAAGCTGGGAGG + Intronic
1183697296 22:39430623-39430645 GTGAGGGAGGTGATGGTGGGAGG - Exonic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184102668 22:42348993-42349015 GTGGGGGAACTGGAGGTGGGAGG + Intergenic
1184291249 22:43499154-43499176 GTGACGGAGGTGATGGTGGGAGG + Intronic
1184501961 22:44879850-44879872 GTTTGGAAAGAGCAGGTGGGTGG + Intergenic
1203232799 22_KI270731v1_random:125754-125776 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
949327870 3:2887384-2887406 GTGTGGAGAGTGAGGGTGGGGGG + Intronic
950186308 3:10947795-10947817 ATGGGGAAGGTGAAGGAGGGCGG + Intergenic
950564416 3:13758593-13758615 ATGAGGAAACTGAAGCTTGGAGG + Intergenic
950584594 3:13883301-13883323 ATGAGGAAAGTGAATCAGGGAGG + Intergenic
950624503 3:14234925-14234947 GTGATGAAACTGAGGGAGGGAGG + Intergenic
951324862 3:21289196-21289218 ATGAGGCCAGTGAAGGTGGCAGG - Intergenic
951364745 3:21767662-21767684 GGGAAGAGAGTTAAGGTGGGGGG + Intronic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
952975953 3:38696553-38696575 GTGAGGAAATTGAAGTTAAGAGG + Intergenic
953056577 3:39392255-39392277 GTGAGGATAGGGTGGGTGGGAGG + Intronic
953386414 3:42508740-42508762 GAGAGGAGAGAAAAGGTGGGAGG - Intronic
953489414 3:43336233-43336255 GGGAGGAAAGGGAAGGAGAGAGG - Intronic
953744676 3:45565227-45565249 GTGATGAAAATGAGGGTGGATGG + Intronic
953820472 3:46203747-46203769 GTGAGGAAAGTGAAGGCTGCAGG + Exonic
953980268 3:47410095-47410117 GGGAGGAAAGTGGAGCGGGGTGG - Exonic
954137360 3:48588190-48588212 GCGAGGACAGTGATGGTGGGCGG - Intronic
954619242 3:51986268-51986290 GTGAGGAGGCTGAAGGTGGAGGG + Exonic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
954808794 3:53235490-53235512 GAGAGGAAAGTGAGGAAGGGTGG + Intronic
955087786 3:55720013-55720035 GGGAGGCAAGGGAAGGAGGGAGG - Intronic
955551668 3:60091747-60091769 GAGAAGAAAGGCAAGGTGGGAGG - Intronic
955599913 3:60634120-60634142 ATGAGGAAAGTGAAGCTCAGAGG - Intronic
956643440 3:71435374-71435396 GGGAGGGAAGGGAAGGAGGGAGG + Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
958426113 3:93980278-93980300 GGGAGGGAAGTGAAGGCGGCCGG - Exonic
958484501 3:94686666-94686688 GTGAGAGAAATGACGGTGGGGGG - Intergenic
958542402 3:95495830-95495852 GGGAGGCAGGTCAAGGTGGGTGG - Intergenic
959002322 3:100978905-100978927 GTGAGTATAGTAAGGGTGGGAGG + Intronic
959145183 3:102535493-102535515 ATGAGGAAAGGTAATGTGGGTGG - Intergenic
959497525 3:107068763-107068785 GTGAGGAAAAAGAAGGTAGGGGG - Intergenic
959774129 3:110135801-110135823 GTCAGGGAAGTGGGGGTGGGGGG + Intergenic
961180925 3:124876780-124876802 GTGAGGTCAGGCAAGGTGGGTGG - Intronic
961474378 3:127137565-127137587 GTGTGGACAGTGGGGGTGGGGGG - Intergenic
961856069 3:129872696-129872718 ATGAGGAAAATAAAGGTGAGGGG + Intronic
962239819 3:133743021-133743043 GGGAGGAAAGAGAGGGAGGGAGG - Intergenic
962330485 3:134473507-134473529 GGGAGGAGGGTGAAGGAGGGAGG + Intergenic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
964858756 3:161176629-161176651 GTGAGAACAGTGATGGTGGATGG + Intronic
964993621 3:162845898-162845920 TTGAGGAAAGACAAGGTTGGAGG - Intergenic
965847967 3:172986825-172986847 GTGAGAAGACTGGAGGTGGGAGG + Intronic
966113954 3:176438572-176438594 GTGAGGAAACTGAAGTTCAGAGG - Intergenic
966142256 3:176769616-176769638 GGGAGGAAAGGGAGGGAGGGAGG + Intergenic
966219497 3:177536220-177536242 GAGAGTCAAGTGAAGGTGGGAGG + Intergenic
966250886 3:177863968-177863990 GTGGGGAAAGAGAACCTGGGTGG - Intergenic
966863083 3:184241467-184241489 CTGAGGAGAGAGGAGGTGGGGGG - Intronic
967069942 3:185953741-185953763 ATGAGGACATTGAAGCTGGGAGG + Intergenic
967137802 3:186527238-186527260 GTCAGCACAGTGAAGATGGGTGG + Intergenic
967235551 3:187380499-187380521 GAGAGGAAATGGAAGCTGGGAGG + Intergenic
967368836 3:188719745-188719767 GTGGGGAAAGTGCAGGTTGGGGG - Intronic
967988083 3:195110930-195110952 GTGAGGTATGTGTATGTGGGTGG + Intronic
968547656 4:1206964-1206986 GTGGGGCAATTGGAGGTGGGTGG + Intronic
968647983 4:1749410-1749432 GTGGGGAAGGGGGAGGTGGGGGG - Intergenic
968870424 4:3239239-3239261 GTGAGGGGAGCGAGGGTGGGCGG + Intronic
969408083 4:7008216-7008238 GTGATGAAAGAGGTGGTGGGCGG + Intronic
969446020 4:7245095-7245117 GTGTGGACAGTGAGAGTGGGCGG + Intronic
969501124 4:7553808-7553830 GAGAGGAAGGTGAAGGTGGGAGG + Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969575328 4:8033214-8033236 GTGAGGAGCATGGAGGTGGGAGG + Intronic
970369871 4:15395813-15395835 ATGAGAAAAATGAAGCTGGGAGG + Intronic
971311581 4:25529949-25529971 GGGAGGAAAGGGAAGGAGAGGGG + Intergenic
971412132 4:26385003-26385025 GAGAGGAAAGGAAAGGGGGGAGG - Intronic
971439174 4:26661323-26661345 GTAAGGAAAAAGAAGGTGGAGGG - Intronic
971505777 4:27365225-27365247 ATGAAGACAATGAAGGTGGGGGG - Intergenic
971506359 4:27370267-27370289 GTGAGAAAAGGGAAGGGGAGGGG - Intergenic
971563102 4:28106264-28106286 GGGAGGGAAGGGAAGGAGGGAGG + Intergenic
971605072 4:28648858-28648880 TTGAGGGAAGTTAGGGTGGGAGG - Intergenic
971920032 4:32926602-32926624 GGCAGGAAAGTGGAGGTGGTGGG - Intergenic
972102097 4:35432687-35432709 GGCAGGAGAGAGAAGGTGGGAGG - Intergenic
972361399 4:38328707-38328729 GGGAGGAAAAAGAAGGAGGGAGG - Intergenic
972412106 4:38805871-38805893 GGGAGGAAATGGCAGGTGGGTGG - Intronic
972575023 4:40343624-40343646 CTGAGGAAAGGGAAGGTAAGAGG + Intronic
972827321 4:42774732-42774754 GTGGGGAAAGTGTAGGAGGTGGG + Intergenic
973718025 4:53696628-53696650 ATGAAAAAAGTGAAGCTGGGAGG + Intronic
974586303 4:63883084-63883106 GTGAGGAAGGGGATGGGGGGTGG - Intergenic
974895821 4:67937320-67937342 GTGAGGAAGGCAAAGGTAGGAGG - Intronic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
975557618 4:75680413-75680435 CTGAGGAAAGTCAAGGTCAGAGG - Intronic
976081150 4:81356212-81356234 GGGAGGAAAGGAAAGGAGGGGGG + Intergenic
976624637 4:87166920-87166942 GTGAGGAGAGTGAGGATGCGGGG + Intronic
977915589 4:102588848-102588870 GAGAGGAAACTGAAGCTAGGAGG - Intronic
978333581 4:107642388-107642410 GTGAGGAACCTGAAGTAGGGAGG - Intronic
978453332 4:108860756-108860778 GTGAGGAAAATAAAGGAGGTAGG + Intronic
978940906 4:114434967-114434989 GTGAGGAAGGTTGTGGTGGGGGG + Intergenic
980511215 4:133790136-133790158 ATGAAGATGGTGAAGGTGGGTGG + Intergenic
980661739 4:135868981-135869003 GTTCGGAAGGTGGAGGTGGGAGG + Intergenic
981559347 4:146030043-146030065 ATTATGAAAGTGATGGTGGGAGG - Intergenic
981995645 4:150971463-150971485 TTGAGGAAAGAGAAGGTGGCTGG - Intronic
982069942 4:151686251-151686273 GTGAGGAAACTGAGGGTCAGAGG + Intronic
982278663 4:153662535-153662557 GTGAGGGAAGTGAAGTTGGGTGG + Intergenic
982311293 4:153988062-153988084 GTGAAGAGGGTGAAGGTAGGAGG - Intergenic
982914024 4:161181964-161181986 GTCAGGAAAGAGGAAGTGGGAGG + Intergenic
984233143 4:177124242-177124264 GAGAGGAAAGAGAGGGAGGGAGG - Intergenic
984604269 4:181766529-181766551 GTGAGCAGAGTGGAGGTGGCAGG + Intergenic
984694387 4:182764891-182764913 GTTAGGAAAGGAAAGGTAGGAGG + Intronic
985011979 4:185592072-185592094 GTGAGGTGAGTGATGGTGGTGGG + Intronic
1202764518 4_GL000008v2_random:138660-138682 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
985544738 5:503969-503991 GTGAGGAAGGTGGGGGTGGGTGG - Intronic
985677048 5:1237578-1237600 GAGAGGCAAGTGGAGGTGGGTGG + Intronic
986038244 5:3961359-3961381 GGGTGGAAAATGCAGGTGGGGGG - Intergenic
986230406 5:5859448-5859470 GGAAGGATATTGAAGGTGGGAGG - Intergenic
986857832 5:11891633-11891655 GTGAGGAAAGAGCAGGAAGGCGG + Intronic
987061382 5:14247063-14247085 GTGGGGAAGGGGGAGGTGGGGGG - Intronic
987344193 5:16964271-16964293 GTGGAGAAAGTGAAGGGGAGGGG - Intergenic
987486615 5:18534342-18534364 TTGAGTTAAGTTAAGGTGGGCGG - Intergenic
987522536 5:19005466-19005488 GTGAGGAAAGTGAAATAGGAAGG + Intergenic
987729082 5:21744409-21744431 GAGAGGAGAGGGAAGGTGAGAGG + Intergenic
988080824 5:26412231-26412253 GCTAGGAAGGAGAAGGTGGGAGG - Intergenic
988556689 5:32242674-32242696 GTGTGGGAAGGGAAGGTGGCTGG - Intronic
988848633 5:35156540-35156562 GTGAGGAAAGTGTTGGTAGGAGG - Intronic
989787879 5:45352747-45352769 TCCAGGAAAGTGAAGATGGGAGG + Intronic
990410475 5:55535719-55535741 GTGAGGGAGGTGACGGTGGATGG - Intergenic
990760340 5:59122392-59122414 GGGAGGAGTGTGTAGGTGGGAGG + Intronic
990852943 5:60227609-60227631 GGGAGGAAAGGGAAGGAGGGAGG + Intronic
991349387 5:65705197-65705219 CTTTGGGAAGTGAAGGTGGGAGG + Intronic
991919575 5:71642279-71642301 GGGAGGAATGAGAAGGTGGGAGG + Intronic
992310973 5:75498771-75498793 GTGAGGATTGTGGGGGTGGGGGG - Intronic
992530524 5:77647646-77647668 CTTAGGAAAGTGCAGGAGGGTGG - Intergenic
992775464 5:80085105-80085127 GTAAGAAAAGTGAAAATGGGTGG + Intergenic
994287633 5:97989584-97989606 GGGAGGAAAAAGAAGGTAGGAGG - Intergenic
995834814 5:116389408-116389430 ATGAGGAAATTGAAGTTTGGGGG - Intronic
996199459 5:120653133-120653155 GAGAGGAAAGTGACTGTGGAAGG + Intronic
996307588 5:122067380-122067402 GTGAGGAAAATGAAGGAGAGAGG + Intronic
996546621 5:124685862-124685884 GTGAGGAAAATGAAGTATGGGGG - Intronic
996765946 5:127034108-127034130 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
997266188 5:132496646-132496668 GAGCGGAAGGGGAAGGTGGGGGG - Intergenic
997296913 5:132774297-132774319 TTGGGGAAAGTGAAGCTGAGGGG - Intronic
997379127 5:133422624-133422646 GTGGGGAAAATCAAGGAGGGAGG + Intronic
998600687 5:143581865-143581887 GGGAGGAGAGTGAGGGAGGGAGG + Intergenic
999588316 5:153116086-153116108 GAGAGGAAAGTGAAGGTGAAAGG - Intergenic
999673377 5:153976450-153976472 GTGAGGAGAGGGAGGATGGGAGG - Intergenic
999969737 5:156847424-156847446 GTCAGGAAACTTAAGGTGGTAGG - Intergenic
1000261773 5:159595289-159595311 ATGAGGTCAATGAAGGTGGGAGG + Intergenic
1000731416 5:164838734-164838756 GAGAGGAAAATGAAGGCGGAAGG - Intergenic
1000797428 5:165682415-165682437 TTGTGGAAAGGGAATGTGGGAGG + Intergenic
1001242662 5:170081985-170082007 GTGAGGACATTGAGGGTGGAAGG + Intronic
1001648823 5:173301264-173301286 GGGAGGAAAGGGAAGGGGAGGGG - Intergenic
1001715949 5:173816159-173816181 GTGAGGAGTGAGATGGTGGGTGG - Intergenic
1001820674 5:174707796-174707818 GTGAGGAAACTGAGGCTCGGAGG - Intergenic
1001878356 5:175220387-175220409 GTGAAGAAACTGAGGCTGGGTGG - Intergenic
1002025738 5:176395188-176395210 GGGTGGGAAGAGAAGGTGGGAGG - Intronic
1002160860 5:177313182-177313204 GAGAGGGGAGGGAAGGTGGGAGG + Intergenic
1002288461 5:178181488-178181510 CTTTGGGAAGTGAAGGTGGGAGG + Intergenic
1003240491 6:4341272-4341294 GTGAGGAGAATGGACGTGGGAGG - Intergenic
1003481492 6:6537575-6537597 GGGGGGAAAGGGAAGGGGGGAGG + Intergenic
1003673460 6:8181322-8181344 GAGAGGAAAGTAAAGGAGGGAGG - Intergenic
1003859432 6:10308620-10308642 CTTTGGGAAGTGAAGGTGGGTGG - Intergenic
1004364876 6:15003522-15003544 GGGATGTGAGTGAAGGTGGGTGG - Intergenic
1004439855 6:15639538-15639560 GTGATGAAAATTAAGGTGGAAGG + Intronic
1005392378 6:25346468-25346490 GTGTGGAAAGTTAAGATTGGTGG - Intronic
1005498410 6:26409153-26409175 GTTAAGAAAGGGAGGGTGGGAGG + Intronic
1006702125 6:35983980-35984002 GTGAGGAAAATGAGAGAGGGAGG - Intronic
1006803189 6:36772216-36772238 GAGAGGAAATTCAAGGTAGGGGG - Intronic
1007182245 6:39937773-39937795 GTGGGCAAGGTTAAGGTGGGCGG - Intergenic
1008057429 6:46959748-46959770 GAAAAGAAAGTGAAGGAGGGAGG + Intergenic
1008386932 6:50902428-50902450 GGAAGGAAAGGGAAGGAGGGAGG + Intergenic
1008605709 6:53137347-53137369 GGAAGGGAAGAGAAGGTGGGTGG - Intronic
1008619637 6:53258943-53258965 GTGAAGGAAGTGAAGGGGGAAGG - Intergenic
1008742636 6:54627968-54627990 GTGGGAAAAATGATGGTGGGTGG + Intergenic
1008957654 6:57233613-57233635 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1009487965 6:64249382-64249404 GTGAGGAAGTTGGAGGGGGGTGG + Intronic
1009848556 6:69165405-69165427 GGGTGTAAAGTGAAGTTGGGGGG - Intronic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010463284 6:76138041-76138063 GTGAGGTAGGGGAAGGGGGGAGG - Intergenic
1010840314 6:80642055-80642077 GAGAGGAAAGTGCAGCTAGGAGG - Intergenic
1011398570 6:86936642-86936664 GTCAGAAAAGTTAAGCTGGGAGG - Intergenic
1011841173 6:91501008-91501030 GGGAGGAAAGTGAAGGAGGGAGG - Intergenic
1011891040 6:92160280-92160302 GGGAGGAGAGTGAAGGGGAGGGG + Intergenic
1012398061 6:98822520-98822542 GTGAGGAAAGGGCTGGAGGGTGG + Intergenic
1012511746 6:100010504-100010526 ATGAGGAAATTCAAGGTGTGTGG - Intergenic
1012961295 6:105624795-105624817 ATGAGGAAACTGAGGGTTGGAGG + Intergenic
1013037858 6:106404166-106404188 ATCTGGAAAGTGAAGTTGGGAGG + Intergenic
1013279397 6:108621736-108621758 GAGAGAAAATTGAAGGTGAGAGG + Intronic
1013337660 6:109181362-109181384 GTAAGAAAAGTGGTGGTGGGGGG - Intergenic
1013943529 6:115694463-115694485 GTTAAGAAATTGAAGGTGGGGGG - Intergenic
1014191191 6:118498648-118498670 GGGAGGAAAGGGAGGGAGGGAGG + Intronic
1014206119 6:118657124-118657146 GTGAGGAAGATGAAGATTGGGGG + Intronic
1015021446 6:128480570-128480592 GAGAAGAAACTGAAGGTGTGTGG - Intronic
1015500068 6:133922621-133922643 ATGAGGAAACTGAAGACGGGAGG + Intergenic
1015725529 6:136295738-136295760 TTTAGGAAGGTGAGGGTGGGAGG - Intergenic
1016798807 6:148147180-148147202 GAGAGGAAAGAGGCGGTGGGCGG + Intergenic
1016862947 6:148739729-148739751 GTGTGGGAGGTGGAGGTGGGTGG - Intergenic
1016892578 6:149021221-149021243 CTTATGCAAGTGAAGGTGGGAGG + Intronic
1017438368 6:154439412-154439434 GGGATGAAAGTGAAGGCAGGGGG - Intronic
1018270009 6:162066963-162066985 GTCAGGCAAGGGAAGCTGGGAGG - Intronic
1018528820 6:164742093-164742115 GGGAGGATTGAGAAGGTGGGAGG - Intergenic
1019332352 7:466662-466684 GGGAGGAGAGTGAAGGAGGAGGG - Intergenic
1019339779 7:503512-503534 GTCAGGAGGGTGAAGGAGGGAGG + Intronic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1020066485 7:5191675-5191697 GTGAGGAAAGAGAAGGAGTGGGG + Intronic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1022416698 7:30184440-30184462 ATGAGGAGACTGAAGGTGAGAGG + Intergenic
1023165287 7:37337375-37337397 GTGGGGTAAGGGAAGGGGGGAGG + Intronic
1023169529 7:37377322-37377344 TTCAGGAAAGTGAAGGTGCCAGG + Intronic
1023578115 7:41651887-41651909 GAGAGCAAAATGAAGGTGGTGGG - Intergenic
1024241197 7:47438135-47438157 GTGAGGAAAGTGGAGGGTGGGGG + Intronic
1024387711 7:48772618-48772640 GTGAGGATAGTAAAGCTGTGGGG + Intergenic
1024641211 7:51330089-51330111 GTGAGGATAGTGATGCTGGCTGG - Intergenic
1025174781 7:56793336-56793358 GCAAGGACAGAGAAGGTGGGTGG + Intergenic
1025198862 7:56949904-56949926 ATGAGGAAAGCGGAGGAGGGAGG - Intergenic
1025248653 7:57337085-57337107 CAGATGAAAGTGCAGGTGGGTGG - Intergenic
1025673084 7:63627029-63627051 ATGAGGAAAGCGGAGGAGGGAGG + Intergenic
1026031819 7:66800863-66800885 GTGGTGAAAGTAGAGGTGGGTGG + Intronic
1026374749 7:69739141-69739163 GGGAGGGAAGTGAAGGTGGTGGG - Intronic
1026677207 7:72437899-72437921 GAGAGGGAAGGGAAGGAGGGAGG - Intronic
1026738054 7:72961294-72961316 TACAGGAAAGTGAAGGTGGCCGG + Intronic
1026789091 7:73320091-73320113 TACAGGAAAGTGAAGGTGGCCGG + Intronic
1027105680 7:75403774-75403796 TACAGGAAAGTGAAGGTGGCCGG - Intronic
1027469769 7:78558631-78558653 GTGAAGAAACTGAAGGATGGAGG - Intronic
1027877602 7:83790287-83790309 GTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1028176147 7:87661406-87661428 GGGAGGGTAGTGAAGGTGGGGGG - Intronic
1028441505 7:90867880-90867902 CTTTGGAAAGTGGAGGTGGGCGG + Intronic
1028540374 7:91936986-91937008 GCGAAGAAAGTGAAGGAGGAGGG - Intergenic
1028703004 7:93804882-93804904 GAGGAGAAATTGAAGGTGGGTGG + Intronic
1028919997 7:96300344-96300366 ATGAGGAAAGTGAGGCTGAGAGG - Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029288372 7:99482609-99482631 GGGAGGGAGGTCAAGGTGGGCGG + Intronic
1029412834 7:100426826-100426848 GGGAGGAAAGGGAAGGAGGAGGG - Intronic
1029450111 7:100636749-100636771 GAGAGGGAAGAGAAAGTGGGGGG - Intronic
1030681213 7:112436391-112436413 GTGATGAAAATGAATGTAGGGGG + Intronic
1030699171 7:112619968-112619990 GTGAGGTAACTGAAAGTGGAGGG + Intergenic
1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG + Intergenic
1031989250 7:128186354-128186376 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1032079437 7:128851321-128851343 GTGACAATAGTGAAGGTGGCTGG - Exonic
1032159668 7:129501015-129501037 GAGAAGAAAGTGCAGGTGGAGGG + Intergenic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033628913 7:143138567-143138589 CTGAGGAAAGTGAGAGTGAGAGG + Intronic
1033842991 7:145397707-145397729 CTTTGGAAAGTAAAGGTGGGAGG - Intergenic
1034434096 7:151054936-151054958 GTGAGGGCAGTGATGGTGTGGGG - Intronic
1034452617 7:151145303-151145325 GTGAGGAAAGGGGAGGAGGTAGG + Intergenic
1034882766 7:154775218-154775240 ATGAGGAAACTGAAGCAGGGAGG - Intronic
1035352466 7:158256289-158256311 CTGAGGAAAGTGGACGTGGCAGG + Intronic
1035602072 8:902764-902786 CGGTGGAAAGTGCAGGTGGGCGG + Intergenic
1036208940 8:6826637-6826659 GTGAGGAATGTGAGGATGGGTGG + Intronic
1036827621 8:11990438-11990460 GTAAGGTAAGGTAAGGTGGGAGG - Intergenic
1037200721 8:16249523-16249545 GTGAGGAAAATGAAGATGAGTGG + Intronic
1037449589 8:19003422-19003444 GTGAGAAGTGTGAAGTTGGGAGG - Intronic
1037547965 8:19941642-19941664 GTGAGTAGAGTGAAAGTGGAGGG - Intronic
1038046374 8:23768798-23768820 GAGAGGGAAGGGAAGGAGGGAGG - Intergenic
1038735691 8:30167025-30167047 GAGAGGAAAGGGAGGGAGGGAGG + Intronic
1039087635 8:33795747-33795769 GAGAGGGTAGTGAAGGAGGGAGG - Intergenic
1039361433 8:36881465-36881487 CTTTGGGAAGTGAAGGTGGGAGG - Intronic
1039407600 8:37326619-37326641 GAGAGGAAAGGGAAGGAGAGGGG - Intergenic
1039419350 8:37422727-37422749 ATGAGGAAACTGAAGCTTGGAGG - Intergenic
1039501748 8:38023299-38023321 GTAAAGAAAGTTAGGGTGGGAGG - Intergenic
1039900902 8:41751937-41751959 GTGATGGAAGGGAAGGTGGTAGG - Intronic
1040026403 8:42786203-42786225 GGGAGGAAAGGGAAGGGAGGAGG + Intronic
1040468546 8:47717230-47717252 GTGAAGAGAATGAAGGTGGAAGG - Intronic
1040812830 8:51475769-51475791 GTGAGGGAAGGGAGGGAGGGGGG - Intronic
1041323795 8:56643074-56643096 ATGAAGAAAGTGAAGTTGAGAGG + Intergenic
1041840134 8:62259870-62259892 GAGACGAAGGTGAAGGTGGGTGG + Intronic
1042781908 8:72500556-72500578 GAGAGGAAAGGGAAAGTGGGGGG + Intergenic
1043403452 8:79906514-79906536 TTGAGGAAACTGAAGAGGGGAGG - Intergenic
1043552411 8:81389707-81389729 GTCAGGAAAGTAAAGGAGGGAGG - Intergenic
1043585236 8:81760902-81760924 GAGAGCAAAGTGGTGGTGGGGGG + Intergenic
1043718679 8:83515996-83516018 ATGAGGAAAGTGAAGCCAGGAGG - Intergenic
1044091346 8:88006286-88006308 GTCAAGAAAGTGAAGGTCAGAGG - Intergenic
1045236996 8:100360785-100360807 GTGAGGAGGTTGAAGGAGGGGGG + Intronic
1045795699 8:106041021-106041043 GTGAGGTAAGTGAATGATGGAGG + Intergenic
1047712540 8:127566871-127566893 ATGAGGAAACTGAAGCTCGGAGG + Intergenic
1047859191 8:128946037-128946059 GTGAAGAAAGTGATGGTCAGAGG + Intergenic
1048297509 8:133225321-133225343 GTGGTGAAAGTGAGGGTTGGGGG + Intronic
1048314112 8:133349572-133349594 GTGAGGGAAGGGAAGGAAGGGGG + Intergenic
1049059720 8:140267066-140267088 GTCAGGAAAGCGAAGATGAGAGG + Intronic
1049188808 8:141274659-141274681 TTGAGGAGAGTGAAGGGGAGAGG - Intronic
1049246061 8:141563221-141563243 GTGAGGAAACTGAGGTAGGGAGG - Intergenic
1049514374 8:143045642-143045664 GGGAGGAAAGTGAGGAGGGGTGG - Intronic
1049664358 8:143836430-143836452 GTGGGGAAAGGGAGGTTGGGCGG + Intronic
1051264092 9:15294636-15294658 GAAAGGAAAGGAAAGGTGGGAGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051777573 9:20652559-20652581 GTTTGGAAAGTCAAGGTGGGAGG - Intergenic
1051818398 9:21135772-21135794 GTGAGGAAAGTGGAGGTTGGGGG + Intergenic
1052047420 9:23810739-23810761 GTGAGGAAAATGAAGCTCAGAGG - Intronic
1053274610 9:36773826-36773848 ATGAGGAAAGTGAAGCTTGTGGG + Intergenic
1053277604 9:36795071-36795093 GTGGGGAAATTGAATGTGGTTGG + Intergenic
1053505600 9:38640913-38640935 CTGAGGAAAGGGAAGCTGAGAGG + Intergenic
1053575932 9:39357531-39357553 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1053840448 9:42185468-42185490 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1054097501 9:60916222-60916244 GTGAGGACTGTGGGGGTGGGGGG + Intergenic
1054118904 9:61191852-61191874 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1054392998 9:64631083-64631105 GCGAGGAAAGTAAGGGGGGGGGG - Intergenic
1054427647 9:65136293-65136315 GCGAGGAAAGTAAGGGGGGGGGG - Intergenic
1054502729 9:65885245-65885267 GCGAGGAAAGTAAGGGGGGGGGG + Intronic
1054588848 9:66990710-66990732 GTGAGGACTGTGGGGGTGGGGGG - Intergenic
1054943659 9:70771557-70771579 AAAAGGAAACTGAAGGTGGGTGG + Intronic
1055015593 9:71614451-71614473 GTGAGGAAAGGGCAGGTGGGAGG + Intergenic
1055656266 9:78453035-78453057 GTGAGGAAAGGGATGGGGGCAGG - Intergenic
1056450158 9:86709108-86709130 GGGAGGGAAGTGAAGCTGGGAGG - Intergenic
1056815654 9:89799021-89799043 GGAAGGAAAGTGCAGGTGTGTGG + Intergenic
1057490081 9:95513790-95513812 GGGAGGAAACAGAAGGTGGAAGG - Intronic
1057516607 9:95727274-95727296 AAGAGGAAAGAGAAGGGGGGTGG - Intergenic
1057528465 9:95823378-95823400 GTGAGGACAGAGGAGGTAGGAGG + Intergenic
1057784389 9:98075449-98075471 GGGAGGAAAGGGAGGGAGGGAGG + Intronic
1057880930 9:98792155-98792177 GTCAGGATGGTGAAGGTGTGGGG - Intronic
1057969084 9:99536286-99536308 GTAGGGCAAGTGAAGCTGGGTGG + Intergenic
1058054653 9:100437161-100437183 GTGAGGAAGGTACACGTGGGAGG + Intronic
1058156956 9:101526690-101526712 GTTGGGAAGGTCAAGGTGGGTGG - Intronic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058710216 9:107672619-107672641 CTTCGGAAAGTGGAGGTGGGTGG + Intergenic
1059376899 9:113889023-113889045 GTGAGGTGAGTGTATGTGGGTGG - Intronic
1059472450 9:114516266-114516288 ATGAGGAAACTGAGGCTGGGAGG + Intergenic
1059549157 9:115210943-115210965 GTGAGGACAGCTAAGTTGGGAGG + Intronic
1059653655 9:116337709-116337731 AGGAGGTAAGAGAAGGTGGGGGG - Intronic
1059726441 9:117013020-117013042 GTAAGGAAAGTGAGGGATGGGGG - Intronic
1060024961 9:120163043-120163065 GTGAGGAAACTGAAGCTGGGAGG - Intergenic
1061009727 9:127947957-127947979 GAGGGGAGAGTGATGGTGGGAGG - Intronic
1061060370 9:128247214-128247236 GTGAGGAAACTGAGGCTGAGAGG + Intronic
1061134072 9:128723456-128723478 ATGAGGGAAATGGAGGTGGGTGG + Intronic
1061373238 9:130209627-130209649 GTTGGGGAAGAGAAGGTGGGAGG + Intronic
1061571290 9:131478922-131478944 GGGAGGAAGGAGAAGCTGGGAGG - Intronic
1061867165 9:133498839-133498861 CTGATGAAAGACAAGGTGGGAGG + Intergenic
1061999000 9:134206662-134206684 GAGAGGAAGGGGAGGGTGGGAGG + Intergenic
1062194178 9:135263991-135264013 GGGAGGAAAGGGAAGGGGAGGGG - Intergenic
1062513690 9:136921638-136921660 GTGTGGAAAATGAACCTGGGAGG - Intronic
1203522328 Un_GL000213v1:55331-55353 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1203446636 Un_GL000219v1:63216-63238 GTAAGGAAAGGGAAGGAGGGAGG - Intergenic
1203545267 Un_KI270743v1:123547-123569 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
1185504923 X:625025-625047 GGGAGGAAAGGAAAGGAGGGAGG - Intronic
1185524451 X:766092-766114 ATAAGGAAAGTTGAGGTGGGAGG + Intergenic
1185581350 X:1213202-1213224 GGGAGGAAAGGGAAGGGGGAGGG - Intergenic
1185734303 X:2485630-2485652 GGGAGGAGAGGGAAGGAGGGAGG + Intronic
1186461407 X:9751243-9751265 TGTAGGAAAGTGGAGGTGGGCGG - Intronic
1187080798 X:15985056-15985078 GTGAGGATATTGATGGTGGAGGG - Intergenic
1187260264 X:17679117-17679139 GTGGGGAAAGTGAGTGGGGGAGG - Intronic
1187323011 X:18257952-18257974 GAGAGGAAAGGGAAGGGGGAAGG + Intronic
1187696791 X:21930431-21930453 GTGAGGAGATCGAGGGTGGGAGG - Intergenic
1187804218 X:23100570-23100592 GTGAAGAAAATGAGGGTGGTGGG - Intergenic
1188058844 X:25575581-25575603 GTAAAGAAAGTGAAGGTTGAGGG + Intergenic
1188530293 X:31132867-31132889 GTGGGGGATGTGGAGGTGGGTGG + Intronic
1190727251 X:53197634-53197656 GTGAGAAAAGAACAGGTGGGAGG - Intronic
1190935727 X:54997615-54997637 TTGTGGAGAGTGAAGGTGTGAGG + Intronic
1192313563 X:70035302-70035324 GAGAGGAAAGAGAGGGTGGGGGG - Intronic
1192529022 X:71870571-71870593 GTGTGGAAGGTGGAGGCGGGGGG + Intergenic
1192866656 X:75140743-75140765 GGTCAGAAAGTGAAGGTGGGAGG - Intronic
1192879448 X:75267425-75267447 GTGGGGTGTGTGAAGGTGGGAGG + Intergenic
1193300259 X:79881060-79881082 GTGAAGAAACTGAGGGTGGATGG + Intergenic
1193319993 X:80109970-80109992 GAAATGAAAGTGAAGGTGGATGG + Intergenic
1193742982 X:85241274-85241296 GAGAGGAGAGAGAAGGAGGGCGG + Intergenic
1195045649 X:101052130-101052152 GTGAGGAAAGAGCAGGTGGTGGG - Intergenic
1196389944 X:115196476-115196498 GTTAGGAGGGTGAAGCTGGGTGG - Intronic
1196736709 X:118986845-118986867 GGGAGGAGGGTGAAGGGGGGAGG - Intronic
1196825631 X:119738181-119738203 GTGAGGTCAGTGGTGGTGGGGGG - Intergenic
1197858561 X:130945773-130945795 ATGAGGAAAGTGAAGCTCCGAGG + Intergenic
1198126480 X:133649144-133649166 GTGATGAGTGTGTAGGTGGGGGG + Intronic
1198530122 X:137544319-137544341 GTGGGTAAAGTGAAGGTAAGAGG - Intergenic
1199449559 X:147964153-147964175 GTGAAGAAAGTGCAGGTTAGTGG + Intergenic
1199614955 X:149649015-149649037 GTAAGGGAGGTCAAGGTGGGTGG - Intergenic
1199637531 X:149827236-149827258 GAGAGGAAAGAGAGGGAGGGGGG + Intergenic
1200022917 X:153226668-153226690 GTGAGGAGAGTGAGGGGGTGTGG + Intergenic
1200134494 X:153868279-153868301 GTGAGGACAGTGACGGTGAAAGG - Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1201341104 Y:12935510-12935532 AGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201341119 Y:12935552-12935574 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic