ID: 914916148

View in Genome Browser
Species Human (GRCh38)
Location 1:151820349-151820371
Sequence TCCCACCACCTGCTGCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914916148_914916154 13 Left 914916148 1:151820349-151820371 CCCTGAAGCAGCAGGTGGTGGGA 0: 1
1: 0
2: 3
3: 37
4: 282
Right 914916154 1:151820385-151820407 AGAAGGAGCTGAGTAATCACAGG 0: 1
1: 0
2: 4
3: 16
4: 271
914916148_914916152 -10 Left 914916148 1:151820349-151820371 CCCTGAAGCAGCAGGTGGTGGGA 0: 1
1: 0
2: 3
3: 37
4: 282
Right 914916152 1:151820362-151820384 GGTGGTGGGAACTCAGATTGGGG 0: 1
1: 0
2: 3
3: 35
4: 290
914916148_914916153 -4 Left 914916148 1:151820349-151820371 CCCTGAAGCAGCAGGTGGTGGGA 0: 1
1: 0
2: 3
3: 37
4: 282
Right 914916153 1:151820368-151820390 GGGAACTCAGATTGGGGAGAAGG 0: 1
1: 0
2: 3
3: 20
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914916148 Original CRISPR TCCCACCACCTGCTGCTTCA GGG (reversed) Intronic
900528481 1:3140900-3140922 TCCGACCGCCTGCTTCTCCAGGG - Intronic
900975514 1:6013793-6013815 ACCCACCCCCTGCTGCTGCCCGG + Intronic
901014577 1:6220967-6220989 TCCCTGCACCTGCTACTTCAGGG + Exonic
901798711 1:11694783-11694805 TCCCACAACCTTCTTCTTCTTGG - Intronic
902374173 1:16022592-16022614 TCCCTCCATCTGCTTCTCCAGGG + Exonic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
904011192 1:27391593-27391615 CCCCATCTCCTCCTGCTTCAGGG + Intergenic
904324621 1:29720277-29720299 TCCCTGCACCTGCTGCCTCTGGG + Intergenic
904453730 1:30633876-30633898 TCTCACCACCTTCAGCCTCATGG + Intergenic
904850382 1:33454831-33454853 TGCCACTTCCTGCTGCTCCATGG - Intergenic
904915427 1:33966915-33966937 CTCCACCACCTGGTGCTTTATGG - Intronic
905488742 1:38327190-38327212 TCCCACCTCCTCCTGCTGCCTGG - Intergenic
906475651 1:46167616-46167638 TCCCCCTACCTGCTCCTTCTGGG + Intronic
907703997 1:56817254-56817276 ACCCACGACCTTCTGCCTCAGGG + Intronic
908820605 1:68082123-68082145 TCCCACCACTCTCTTCTTCAAGG - Intergenic
913184762 1:116360130-116360152 TACCACCACCACCTGCTTCATGG + Intergenic
913510105 1:119553629-119553651 TCTCACCACCTGCAGCCCCAGGG + Intergenic
914916148 1:151820349-151820371 TCCCACCACCTGCTGCTTCAGGG - Intronic
915597508 1:156904001-156904023 TCCCAATACCTGCAGCTTCTGGG + Exonic
918189697 1:182162377-182162399 TACCTCCACATGCTGCATCATGG - Intergenic
920199367 1:204250076-204250098 TGCCACCTCCTGCTGCTACCTGG + Intronic
920513640 1:206568375-206568397 TCCCTCCACCTGCAGCTTTGAGG - Intronic
920683688 1:208092809-208092831 CCCCACCACCTGCTCCTTCCAGG - Exonic
922444287 1:225683582-225683604 TACCACGGCCTTCTGCTTCATGG - Intergenic
922816102 1:228450507-228450529 TGCCACGACCTGTAGCTTCAAGG - Intergenic
922902620 1:229148406-229148428 TCCCACCTCCAGCTGCTCCCTGG + Intergenic
1063083080 10:2786955-2786977 TCCCACCAGTTGCTCCCTCAAGG + Intergenic
1063167011 10:3472490-3472512 TGCCACCACACTCTGCTTCAAGG - Intergenic
1063513279 10:6668387-6668409 TCCCAGCACTTGCTTCTTCAGGG + Intergenic
1064035211 10:11908844-11908866 TCACCCCACCTGCTCCTCCATGG + Intergenic
1066012943 10:31210919-31210941 TCCCATCCCCTGCTGCTCCCTGG + Intergenic
1066142006 10:32514229-32514251 TCTCACCCCCTGCTACCTCAGGG + Intronic
1066216304 10:33291448-33291470 TCCCATCATTTGCTGCTTCAGGG + Intronic
1069958826 10:72067899-72067921 TCCCACCACCCACTCCTTCCTGG + Intronic
1070630958 10:78084382-78084404 TCCTACCACCTGGGTCTTCAGGG - Intergenic
1073166433 10:101457332-101457354 TCCCACCACCAACATCTTCATGG - Intronic
1074094665 10:110300633-110300655 TCACAACACCTGATGCTTCCTGG - Intronic
1074264341 10:111886470-111886492 TTGCTCCACCAGCTGCTTCAGGG + Intergenic
1074298088 10:112209589-112209611 TCCTGCCTGCTGCTGCTTCATGG + Intronic
1075092278 10:119450553-119450575 TCCTTCCACATGCTGCTTCCAGG - Intronic
1076741562 10:132488266-132488288 TCCCAGCTCCTGCTGCTCCAGGG - Intergenic
1076759777 10:132597370-132597392 TCCCACCACCTGCAGGAACAGGG - Intronic
1077214230 11:1388727-1388749 TCCCACCACCTTCTGCAGCACGG + Intergenic
1078387481 11:10905188-10905210 TCCCACCAACAGCTGCCTCTGGG - Intergenic
1078916971 11:15787454-15787476 TCCCTCTACTTGCTCCTTCAGGG - Intergenic
1079920421 11:26427287-26427309 TCCCTCCACCTGCACCTTGATGG + Intronic
1080448853 11:32362238-32362260 TCCCACCTCCTCCTGCTTAAAGG + Intergenic
1080485980 11:32707010-32707032 TCCCACAAAGTGCTACTTCATGG - Intronic
1081707578 11:45193672-45193694 GCCCACCACCTGTTTCTGCATGG - Intronic
1083096296 11:60254666-60254688 TCGCACCATCTGCAGCTTGATGG - Intergenic
1083228645 11:61300818-61300840 TGCCACCACCTCCTGCATCTTGG + Exonic
1083548440 11:63566239-63566261 TCCCACCATCTGCTGTTTGCAGG - Intergenic
1083735004 11:64675190-64675212 TTCCTCCAGCTGCTGCTTCTAGG - Intronic
1083767554 11:64849107-64849129 TCCCACCAGATGGTTCTTCAGGG + Intergenic
1083953865 11:65971666-65971688 TCCCACCATCCACTGCTTCAGGG - Intronic
1084268324 11:68016297-68016319 ACCCAGCACCTCCTGCCTCAGGG - Intronic
1084953753 11:72680598-72680620 GCCCACCACCTGCTGTGCCAAGG - Intergenic
1085017604 11:73185640-73185662 TCCCAGCACCTGCTTCTGGATGG + Intergenic
1085724389 11:78941618-78941640 CCCCAGCACCTGCTGCTTGTGGG - Intronic
1085745361 11:79110346-79110368 TCTCAACCCCTTCTGCTTCAGGG - Intronic
1086085231 11:82946269-82946291 TCCCAGCTCCTGCAGCTCCATGG + Intronic
1086097976 11:83069603-83069625 TCCCACCACCAGCTGCAGCAAGG + Intronic
1088688617 11:112305660-112305682 TCCCACCAGCTGGGCCTTCAAGG - Intergenic
1089012063 11:115139567-115139589 TCCCATCAACTGCTGCTTGCTGG + Intergenic
1089692582 11:120196082-120196104 TCCCAAGAACTGCTGTTTCACGG + Intergenic
1089875931 11:121722452-121722474 TCCCACCACCCCCTGCTTCTCGG + Intergenic
1090549929 11:127808661-127808683 TCCCACCTCCAGCTGCCTCCTGG + Intergenic
1090977244 11:131688520-131688542 TCCCTCCGCCTGCTGCTCCCAGG + Intronic
1091789933 12:3266220-3266242 ACCCACCACCTCCTGCTGCTGGG - Intronic
1091960690 12:4691719-4691741 CCCCACCACCCTCTGCTTCCAGG - Exonic
1091998139 12:5011225-5011247 TCCCACCAGTTGATGCTGCAGGG + Intergenic
1092287408 12:7136773-7136795 TTTCACCATCTGCTGCTTCTTGG + Intronic
1093362203 12:18243601-18243623 TCTCACCACTTGTTTCTTCAGGG - Intronic
1093773059 12:23039577-23039599 TCTCAACACCTGCTGCTGAAAGG - Intergenic
1093849736 12:24020944-24020966 TCCCAACAACTGCTGGTTTATGG + Intergenic
1094494905 12:30983097-30983119 GCCGACCACCTGCTGCTTATGGG + Exonic
1094650355 12:32369995-32370017 TCCCACCACCTTCAGCAACAGGG + Intronic
1096542968 12:52318482-52318504 TCCCACCACCTGCAGCTGAGTGG - Intronic
1096647324 12:53045970-53045992 ACCCTCCACCTTCTGCTCCAGGG + Intergenic
1097067772 12:56333496-56333518 TCCCTTCACCTGATGATTCAGGG - Exonic
1097235155 12:57534363-57534385 AGCAACCAGCTGCTGCTTCAGGG + Exonic
1097364936 12:58701726-58701748 TCCCCCTGCCTGCTGCCTCACGG - Intronic
1099397826 12:82163042-82163064 TCCCTCCACCTGCTTCTTAAAGG + Intergenic
1104248540 12:127066739-127066761 TCCCATCACATGCAGATTCAGGG - Intergenic
1104654668 12:130565042-130565064 TCCTTCCCCCTGCTGCTTTATGG - Intronic
1104726384 12:131078078-131078100 TCCCTCCTCCTGCTGCTTCAGGG + Intronic
1105997788 13:25688690-25688712 CCCCAGCGCCTGCTGATTCAGGG + Intronic
1112549832 13:100409180-100409202 CCCCACCGCCTGCTGCTCCCAGG - Intronic
1113098729 13:106694525-106694547 TCCCACTCACTGCTGCTCCAAGG + Intergenic
1115243322 14:31270481-31270503 TCCCACCATCTGCAGCCTGATGG - Intergenic
1116044834 14:39732003-39732025 TCCCACCACCTACAGCATCCTGG - Intergenic
1119747324 14:77053485-77053507 TAGCACCACCTGCTGCTGCCGGG + Intergenic
1119768159 14:77203808-77203830 CCCCACCTCCTGCTGCTGCCAGG - Intronic
1120815834 14:88857231-88857253 TACCATTTCCTGCTGCTTCAGGG - Exonic
1121515034 14:94543821-94543843 ACCCACCTTCTCCTGCTTCAGGG - Intergenic
1122130361 14:99601716-99601738 TCCCACCACAGGCTGCTTCAGGG - Intronic
1122944232 14:104998606-104998628 TTCCCGCACCTGCTACTTCAGGG - Intronic
1123119610 14:105910695-105910717 TCCCATATCCTGCTCCTTCATGG + Intergenic
1123974084 15:25536165-25536187 TCCCACCTCCTGTTCCCTCACGG + Intergenic
1124440391 15:29681604-29681626 TCGCCCTACCTGCTGCTTCATGG + Intergenic
1124945594 15:34262619-34262641 TCCCACCATCTGCAGCCCCATGG - Intronic
1126467402 15:48973392-48973414 TCCCTCCTGCTGCTGCCTCAGGG + Intergenic
1127287804 15:57546095-57546117 CTCCTCCACCTGCCGCTTCATGG - Exonic
1130443677 15:83978922-83978944 GCCCACCACCTGAGGCTTCATGG + Intronic
1132570536 16:642123-642145 GCCCTCCACCTGCTGCTGCGTGG - Exonic
1132839882 16:1973815-1973837 GCCCACCCCCTACTGCCTCAGGG + Intronic
1133102142 16:3486059-3486081 TGCCACAAGCTGCTGCTCCAAGG + Exonic
1133302813 16:4793170-4793192 TCCCTCCACCCTCTGCTTCCAGG - Intronic
1133319991 16:4907392-4907414 TCCCACCACCTGATCCTACAAGG - Intronic
1136343869 16:29663113-29663135 CACCATCACCTGCTCCTTCAGGG - Intronic
1139474987 16:67198630-67198652 CCCCACCACCTGCAGGTTCTAGG - Exonic
1139760867 16:69183931-69183953 ACCCACCTCCTCCAGCTTCATGG - Intronic
1139782712 16:69365033-69365055 TGCCAACCCCTGCTGCTTTAGGG + Intronic
1140294115 16:73691425-73691447 TCCCACCTTCTGTTCCTTCAAGG - Intergenic
1141696388 16:85621799-85621821 TCCCCTCCCCTGCTTCTTCAAGG - Intronic
1141759646 16:86019517-86019539 TCCCTCCACCTGCAGTTTGAAGG - Intergenic
1142134156 16:88443987-88444009 TGCCTCCCCCTGCTGCTTCAGGG - Intergenic
1143014419 17:3884048-3884070 ACCCACCACCAGCTGGCTCACGG + Intronic
1143682844 17:8490502-8490524 TTCCTCCACCTGCTGCTCTAGGG + Exonic
1144061183 17:11584007-11584029 TGCCATCAGCTGCTGCTGCAGGG - Intergenic
1144211295 17:13017756-13017778 TGCCACCACCTGCAGGTACACGG + Exonic
1144454342 17:15406648-15406670 CCCCACCACCAGCTGGTCCATGG + Intergenic
1145002816 17:19317435-19317457 TAGCACCACCTGCTGCTGCCAGG - Intronic
1146635488 17:34501311-34501333 TCCTTCCTCCTGCTGCTGCAGGG - Intergenic
1147256194 17:39183909-39183931 TCCCTCCACCTGCTGTTCCTGGG - Intronic
1147725345 17:42563275-42563297 TCCCACCACAAGCTGCTCCTGGG - Exonic
1147925277 17:43941964-43941986 TCCCACTAGCTGCTGCCTCCTGG - Intronic
1148063210 17:44850690-44850712 TCCCACTCCATGCTGCTTCTGGG - Exonic
1148388994 17:47256553-47256575 TCCCACCATCTGCTTCCCCAGGG - Intronic
1149953625 17:61020378-61020400 TACCTCCAAGTGCTGCTTCAAGG - Intronic
1150816959 17:68400017-68400039 TCCCCACACCTGCGGCTTCCAGG - Intronic
1150891882 17:69161506-69161528 TCCCACCACATTATACTTCATGG - Intronic
1152447265 17:80353079-80353101 TTCCACCACCTGCTCCCCCAGGG - Intronic
1152582659 17:81173431-81173453 CCACCCCACCTGCTGCTTCATGG - Intergenic
1153212388 18:2781211-2781233 TCTCAACTCCAGCTGCTTCAGGG + Intronic
1154133096 18:11752557-11752579 ACCCACCGCCTGCTGCTCCTGGG + Intronic
1156104432 18:33641323-33641345 TTCCACCCCGTTCTGCTTCAGGG + Intronic
1156968380 18:43124460-43124482 TACCAACACTTGCTTCTTCAAGG - Intergenic
1158005846 18:52671228-52671250 TCCCACCACTGGAGGCTTCAAGG + Intronic
1158757665 18:60346226-60346248 TCCCACCAGGTGCTGGCTCAGGG - Intergenic
1158944855 18:62439158-62439180 CCCCACCCCCTACTGCCTCATGG - Intergenic
1159916638 18:74193954-74193976 TCCCGTCACCAGCTGCCTCATGG + Intergenic
1160120225 18:76123567-76123589 TCCCCCCACGAGTTGCTTCAGGG + Intergenic
1160354513 18:78215809-78215831 ACCCTCCACTTGCAGCTTCAAGG - Intergenic
1160961777 19:1725419-1725441 TCCCACCACCCGCTACCTCGGGG - Intergenic
1161646535 19:5456580-5456602 CTCCACCACCTACAGCTTCAGGG + Exonic
1162492603 19:11002668-11002690 TCCCAACACCTGTTTCTTTAAGG - Intronic
1162933381 19:13968424-13968446 CCCCACCCCCTGCTGGTTCTCGG + Intronic
1163082333 19:14953055-14953077 TCCCTCCCCCTGCAGCATCACGG - Exonic
1164046186 19:21544080-21544102 TCACAGCATCTGCTGCTTCAGGG - Intronic
1165094364 19:33402413-33402435 TCACACCACCTGCTTCTTCCAGG + Intronic
1165178144 19:33945193-33945215 TCACACCACCAGCTGCCTCTGGG - Intergenic
1166299650 19:41906604-41906626 CCCCACCTCCAGCTGCTTCATGG - Exonic
1168353841 19:55690445-55690467 TCCCACAACCTTGTGCTTCCAGG + Intronic
925238053 2:2296706-2296728 TGCCACCTCCTGCTGCCCCAGGG + Intronic
925429765 2:3780979-3781001 TGGCGCCACCTACTGCTTCAAGG + Intronic
927282402 2:21320793-21320815 TCCAACCACATGCTGCCTCTGGG - Intergenic
927554606 2:24023083-24023105 TCCCGCCACCTGCTTCTTCGTGG - Intronic
927846974 2:26476775-26476797 TCTGAGCACCTGCTGCTTGAAGG + Intronic
931635511 2:64337714-64337736 CCCCACCTCCTGTTGCTTCTTGG - Intergenic
932409656 2:71538020-71538042 TGCAGCCACCTGCTGCTTCCCGG - Intronic
932495406 2:72143558-72143580 TCCCACCACAGGCTGCTTGAAGG - Intronic
932497528 2:72153750-72153772 CCCCACCCCTTGCAGCTTCAGGG + Intergenic
932679991 2:73816634-73816656 TCCCTCAATCTGCTGCTTCTAGG + Exonic
932750826 2:74370688-74370710 TGCCTCCACCTCCTGCTGCAGGG + Exonic
932771412 2:74502761-74502783 TCCCACCGCTGGCTGCTTCCCGG - Intronic
935119890 2:100175288-100175310 TCCCATCACTTGCTGCTCCTTGG - Intergenic
935275194 2:101470371-101470393 TCCAACCACCTGGGGCTCCAAGG + Intronic
936243815 2:110809511-110809533 TCCCAGCACCAGGAGCTTCAGGG + Intronic
936449152 2:112620420-112620442 TGCCAGCACCTCCAGCTTCATGG - Intergenic
937083577 2:119157066-119157088 GCCTCCCGCCTGCTGCTTCAGGG + Intronic
937294198 2:120799886-120799908 GCCAACCACCTGCAGCTTCCAGG - Intronic
938245368 2:129772680-129772702 TCCCACCACCAATAGCTTCAGGG + Intergenic
939641088 2:144640654-144640676 TCCAACCAACTCCTGCCTCAGGG - Intergenic
941893922 2:170610620-170610642 TCCCACTACATCCTGCTTGATGG + Intronic
941929795 2:170928574-170928596 TTCCACCACCTGCTGCTGCTCGG - Exonic
942686954 2:178542834-178542856 GTCCACCTCCTGCTGCTTCCTGG - Exonic
943906301 2:193503636-193503658 TCCTAGGCCCTGCTGCTTCATGG - Intergenic
947670729 2:231933935-231933957 TCCCGCCACCAGCTTCTCCAGGG + Intergenic
948271037 2:236673497-236673519 TCCCACCACCTTCTGCAAGATGG + Intergenic
948591643 2:239054285-239054307 ACCCAGGACCTGCTGCTTGAGGG + Intronic
1169397869 20:5250844-5250866 TTCCACCACCTGCAGCATCCTGG - Intergenic
1173152350 20:40578379-40578401 CCTCCCCACCTGCTGCTTCCAGG - Intergenic
1174150164 20:48480757-48480779 TCCCACCACCTGCAGTTACCTGG + Intergenic
1174157731 20:48527676-48527698 CTCCACCTCCTGCTGCTTCTGGG - Intergenic
1175126009 20:56752023-56752045 TCTCAGCACCTGCTGCTCCTGGG - Intergenic
1175289953 20:57868950-57868972 TCTCTCCACCTCCTGGTTCATGG + Intergenic
1175389856 20:58620227-58620249 TCCCACCAGCTGGGGCTTGAGGG - Intergenic
1175424537 20:58855312-58855334 ACGCACCGCCTGCTGCTTCTAGG + Exonic
1176307167 21:5129791-5129813 TCCCACCAGCTGATGCTCCCTGG - Intergenic
1178301547 21:31457789-31457811 TCCCCCCACCTCCTGCCTCCAGG + Intronic
1179575257 21:42304588-42304610 TGCCACCACATGGTGCTCCATGG - Intergenic
1179849892 21:44132239-44132261 TCCCACCAGCTGATGCTCCCTGG + Intergenic
1180039892 21:45270511-45270533 TCCCACCACCTGCAACCTCCTGG + Intronic
1180594447 22:16964131-16964153 GCCCACCACCTGAGGCTGCATGG + Intronic
1180875841 22:19174984-19175006 CCCCACCTCCTGCTGCCCCAGGG + Intergenic
1180931717 22:19596756-19596778 TCCCACCACCCTCTGCTGCTGGG + Intergenic
1181818235 22:25455880-25455902 TCCCAGGACCTCCTGCTCCAAGG - Intergenic
1182607932 22:31521653-31521675 TCCTACCACCTACTGCTTCATGG + Intronic
1182681591 22:32083966-32083988 TCCCACCACATGCTGGGTCCAGG + Intronic
1183060382 22:35333188-35333210 TGCCACCACCTGATGCCCCAGGG + Intronic
1184203650 22:42986490-42986512 TCTCACCACCCGCCACTTCAGGG + Intronic
1184320673 22:43740008-43740030 GCCCCCCACCTGCTGCTTTCTGG + Intronic
1184434551 22:44462452-44462474 GCCCACCAACTCCTGCTTCTGGG + Intergenic
1184678102 22:46054292-46054314 TCCCCCCTCCTCCTGCTTCGCGG + Intronic
1185048873 22:48543415-48543437 CCCCACCACCTGCTGTTCCTGGG - Intronic
1185065141 22:48628335-48628357 TCCCAGCCCCTCCTGCTTCCTGG + Intronic
1185373199 22:50470227-50470249 TTCCTCCACCTGCTGCCTCGTGG - Intronic
949730855 3:7111112-7111134 TCTCATCACTTCCTGCTTCAGGG - Intronic
950870495 3:16224344-16224366 TCCCATCACCTGCTACAACATGG + Intronic
950895821 3:16449935-16449957 GCCCTCCTCCTGCTGCTTCCTGG - Intronic
952036247 3:29205649-29205671 TCCCACCATTTTCTTCTTCAAGG + Intergenic
952171380 3:30810869-30810891 TCCCTCCCCCTCCTGCTACAAGG + Intronic
953145198 3:40268515-40268537 CCTCACCACCTAATGCTTCATGG - Intergenic
953907235 3:46874505-46874527 CCCCACCACCTCCTCCTTCCTGG + Intronic
954129453 3:48552703-48552725 ACCCCCCAACTGCTCCTTCAGGG + Intronic
954131536 3:48563700-48563722 TACCGCCACCAGCTGCTTCTGGG + Exonic
954812762 3:53258037-53258059 CCCCACCACCTGGAGCTCCAGGG + Intergenic
955221509 3:57027052-57027074 TCCCACCAACTGCAGAGTCAAGG - Intronic
956034835 3:65079602-65079624 GCTCTCCATCTGCTGCTTCACGG + Intergenic
956466769 3:69527357-69527379 GCCAAGCACCTGCTGCTTCTTGG + Intronic
957232319 3:77536224-77536246 TCCCCCCACCTGCTTCTTTGTGG - Intronic
958814198 3:98898754-98898776 TTCCACCACGGGCTGCTTTAGGG + Intronic
960425917 3:117507788-117507810 TCCCACCACCCCCAGCTTCTAGG - Intergenic
962951644 3:140225173-140225195 TTCCCCCACCTGCTGCTTTATGG + Intronic
963844517 3:150141549-150141571 TTCCTCCACCTGCAGCTTAAGGG - Intergenic
966620133 3:181954464-181954486 TTTAACCACCTGCTACTTCAAGG - Intergenic
966935931 3:184709437-184709459 GCCCACCACCTTCTGCGTGAGGG - Intergenic
967124794 3:186413824-186413846 CCCCACCCCCTGCTGCTTGGTGG - Intergenic
967866578 3:194194865-194194887 TCCCATCACAGGCTGCTTCCTGG - Intergenic
968957174 4:3725369-3725391 TCCCACACGCTGCTGCCTCAGGG + Intergenic
969590874 4:8121337-8121359 GCCCAGCTCCTGCTGCTTCCAGG + Intronic
971160114 4:24125346-24125368 TCTCCCCATCTGCTTCTTCAAGG + Intergenic
971411772 4:26380642-26380664 TCCAATCAATTGCTGCTTCATGG + Intronic
977841508 4:101712175-101712197 TCACACCCCCTGGTGCTTGACGG - Intronic
981960630 4:150533881-150533903 TTCCACCACCTTCTGTTTTATGG + Intronic
983635034 4:169889220-169889242 CCCCAACATCTGCTGCTTCCTGG - Intergenic
984866885 4:184288548-184288570 TCTAACCACCTGCTGCAGCAGGG - Intergenic
985667349 5:1187949-1187971 TCCAAGCACCTGCTCCTTCAAGG - Intergenic
985793582 5:1945902-1945924 ACCCACCACCTGCTCATTGAGGG + Intergenic
986307424 5:6525868-6525890 TCCCCCCACCCGCTATTTCATGG - Intergenic
986431244 5:7683241-7683263 GCCCACAAGCTGCAGCTTCAGGG - Intronic
989122571 5:38019066-38019088 AACCACCACCTGCAGCGTCAGGG - Intergenic
991358084 5:65790686-65790708 TCACATCACCTGCTGCTTTATGG + Intronic
993405369 5:87505360-87505382 TCTCCCCACTTGTTGCTTCAGGG - Intergenic
993965994 5:94361349-94361371 TCACACCATCTGCTGCCTCCAGG + Intronic
996388031 5:122929219-122929241 GCCTCTCACCTGCTGCTTCAGGG + Intronic
999256212 5:150211206-150211228 ACCCACCACCTACTGCCACAGGG - Intronic
1001668449 5:173453570-173453592 TCCCATCTCCAGCTGCTTAAGGG + Intergenic
1001917830 5:175576169-175576191 TCCTCCCACCTGCACCTTCATGG - Intergenic
1001998051 5:176177768-176177790 CGCCCCCACCTGCTGCTTCCAGG - Intergenic
1002447373 5:179297751-179297773 GCCCACCACCAGCTCCCTCAGGG + Intronic
1003318894 6:5035495-5035517 CTCCCCCACCAGCTGCTTCAAGG + Intergenic
1003520480 6:6854365-6854387 TCTCTCCACCTGCTGCTTTGAGG - Intergenic
1004336533 6:14769525-14769547 TCCCAGCAGCTGCTCCTTCCTGG - Intergenic
1006106347 6:31719191-31719213 TAACACCACCTGCTGCAACAAGG - Exonic
1006116592 6:31779115-31779137 TCCATCCACCTGCAGCTTCAGGG - Exonic
1006283263 6:33073399-33073421 TCACATCAATTGCTGCTTCAGGG - Intronic
1006410930 6:33872817-33872839 TCCCTCCACCTGCTTCTTCCAGG - Intergenic
1007256650 6:40534409-40534431 TCCCCCCAACTGCTGATCCATGG + Intronic
1009445180 6:63733975-63733997 TGCCTCCACCTGCTGATTAAAGG - Intronic
1015398650 6:132763530-132763552 TCCCAGCAGCTGCTGGTTCAAGG + Intergenic
1015544925 6:134352101-134352123 TCCCACTGCCTGCTGAATCAAGG + Intergenic
1016013534 6:139162286-139162308 TCCCCACTCCTACTGCTTCAAGG - Intronic
1016987397 6:149905551-149905573 ACCGAGCACCTGCTCCTTCAGGG - Intergenic
1017543460 6:155426684-155426706 TTCCACCTCCTGCTCCCTCATGG - Intronic
1018627276 6:165792127-165792149 TTCCCACACCTGCTGCTTCTCGG + Intronic
1020334653 7:7053375-7053397 TCCCATCCCCAGCTGCTTGATGG + Intergenic
1022302134 7:29111651-29111673 TCCCACCACAGGCTGCTTTGGGG + Intronic
1023859721 7:44211131-44211153 ACCCAGCACCTGCTGCCTCCTGG + Intronic
1023904708 7:44513860-44513882 AGCCACCACCTGCAGCTCCAAGG + Intronic
1024232128 7:47370743-47370765 TCCCACCACCAGCAGCTCCCTGG - Intronic
1024965639 7:55020058-55020080 TACCACCACCTGCGGCTCCCGGG + Intronic
1025605789 7:63039014-63039036 TCCCCCCTCCTGCTGCCTCCTGG - Intergenic
1027001287 7:74656689-74656711 TCCCCCCACCCGCCGCTTCTCGG - Intergenic
1027622706 7:80510721-80510743 TCCCAGCACTTGCTCCTTAAAGG - Intronic
1027916760 7:84334633-84334655 TCCCCCAACCTGCTGCCTCCTGG + Intronic
1029524815 7:101088115-101088137 CCCCAGCACCTCCTGCTTCTGGG - Exonic
1030005415 7:105113164-105113186 TTCCAACACCTACTGCTTCAGGG + Exonic
1030495999 7:110301448-110301470 TCTCTCCTCCTGCTGCATCACGG + Intergenic
1031976825 7:128099264-128099286 TCCCTCACCCTGCTGCTTGAGGG + Intergenic
1035311611 7:157973158-157973180 TCCCACCCACTGCTGCTCCAGGG - Intronic
1035464361 7:159064975-159064997 TCCCACCGCCTGCTTCTGGAAGG - Intronic
1037400469 8:18490825-18490847 TCCTGCCAACTGCTGCTTCACGG - Intergenic
1038010909 8:23475141-23475163 GGCCACCATCTGCTGCTGCATGG + Intergenic
1038055417 8:23853304-23853326 TCCCACCACCCGCAGCCTCTAGG + Intronic
1039461665 8:37750427-37750449 TTCCACCACCTTCTGTTTCTGGG - Exonic
1040103681 8:43526682-43526704 TCCCACCCCCTGCTCTTTCCAGG - Intergenic
1041706685 8:60853531-60853553 TCTCACAACCAGCTGCTGCAGGG - Intronic
1043701310 8:83291624-83291646 CCCCACCACCTGCTGCTGCGGGG - Intergenic
1045707425 8:104942251-104942273 TCCCAACAGCTTCTGCTTTAGGG + Intronic
1047458373 8:125037770-125037792 TACCACCACTCGCTGCTACATGG - Intronic
1048331452 8:133473550-133473572 TCCCAGCAACTGCTGCTACAGGG + Intronic
1048361894 8:133704581-133704603 ACCCCACACCTGCTGCTTCATGG - Intergenic
1048854910 8:138678355-138678377 TCACACTACCTGCTGTTTCTGGG + Intronic
1048960461 8:139572675-139572697 GCCCAACACCAGCTGCTTCATGG - Intergenic
1049010204 8:139882327-139882349 TCCAGCCACGTGCTGCGTCAGGG - Intronic
1050552927 9:6763150-6763172 TCCCCCCTGCTCCTGCTTCAAGG + Intronic
1051628658 9:19122831-19122853 ACCCACCCCCTGCTGGTCCATGG + Intronic
1052347963 9:27428927-27428949 TCCCACCACCTGGTGGAACAGGG + Intronic
1054746991 9:68864311-68864333 TAGCACCAGTTGCTGCTTCATGG - Intronic
1056876490 9:90338348-90338370 CCCCAGCACCTGCTGCTCAATGG - Intergenic
1057777893 9:98025689-98025711 TCCCACCACTTGCTTGTTTAAGG - Intergenic
1059269184 9:113061404-113061426 CCCCACCACCTGCCGGATCAGGG + Intergenic
1059270319 9:113066853-113066875 CCCCACCACCTGCCGGATCAGGG + Intergenic
1059271455 9:113072303-113072325 CCCCACCACCTGCCGGATCAGGG + Intergenic
1059272586 9:113077747-113077769 CCCCACCACCTGCCGGATCAGGG + Intergenic
1059273721 9:113083189-113083211 CCCCACCACCTGCCGGATCAGGG + Intergenic
1059274856 9:113088635-113088657 CCCCACCACCTGCCGGATCAGGG + Intergenic
1060788680 9:126470514-126470536 CCCCCCCACCTCCTCCTTCAGGG - Intronic
1061342537 9:129994245-129994267 TCCCACCACATGCTACCACATGG + Intronic
1062048836 9:134436947-134436969 TCCCAACTCCTGCAGCTCCAGGG - Exonic
1062059364 9:134486662-134486684 TCCCACCACGAGCGGCTTCGAGG - Intergenic
1062619637 9:137414276-137414298 TTCCAGCACATGCTGCTGCAGGG - Intronic
1203751363 Un_GL000218v1:83639-83661 TCCCACCAACAGCTTCTACAGGG + Intergenic
1186119956 X:6350102-6350124 CCCCACCACCTCATGCTGCATGG - Intergenic
1186509423 X:10119312-10119334 TCCCACCACCTTCTCCTTAAGGG + Intronic
1189287350 X:39861043-39861065 TTCCACCCCCTGCTTCCTCATGG - Intergenic
1189337948 X:40182208-40182230 ACCTACCTCCTGCTGCTTCCTGG + Intergenic
1190233977 X:48602044-48602066 TCCCTCCCTCTGCTGCTGCAGGG + Exonic
1192314942 X:70044060-70044082 TCTCACCCCCTGCTGTTTCCTGG + Intronic
1192683431 X:73278300-73278322 TCACACCACCTATTTCTTCAGGG - Intergenic
1199028756 X:142972174-142972196 GACCACCACCCGCTGCTCCACGG - Intergenic