ID: 914917964

View in Genome Browser
Species Human (GRCh38)
Location 1:151829948-151829970
Sequence TGTGAAGGCAGGGACTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 429}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914917957_914917964 -3 Left 914917957 1:151829928-151829950 CCTGCCAAATTGTAAAGCCCTGT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 914917964 1:151829948-151829970 TGTGAAGGCAGGGACTGTGTTGG 0: 1
1: 0
2: 5
3: 42
4: 429
914917958_914917964 -7 Left 914917958 1:151829932-151829954 CCAAATTGTAAAGCCCTGTGAAG 0: 1
1: 0
2: 0
3: 29
4: 812
Right 914917964 1:151829948-151829970 TGTGAAGGCAGGGACTGTGTTGG 0: 1
1: 0
2: 5
3: 42
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914917964 Original CRISPR TGTGAAGGCAGGGACTGTGT TGG Intronic
901504911 1:9678612-9678634 TGTGCAGGGAAGGACTGTTTAGG + Intronic
901765455 1:11497009-11497031 TGAGAAGGCAGGCACGGGGTGGG + Intronic
902103284 1:14011597-14011619 TGTCGAGGGAGGGATTGTGTAGG + Intergenic
902621899 1:17655739-17655761 TGTGAAGGCAGGATGTGTGTGGG + Intronic
903323251 1:22554972-22554994 TGTGGGGGCGGGGATTGTGTGGG - Intergenic
903563698 1:24248334-24248356 GGTGATGTCAGGGACTGGGTTGG + Intergenic
903597205 1:24503483-24503505 TGTGAAGGCAGGAGCGGTGTAGG + Intronic
904425956 1:30423179-30423201 TGTCATGGAAGGGACTGGGTGGG + Intergenic
907095222 1:51772639-51772661 TGCGGAGGCAGGGTCTGTGGAGG + Exonic
907372737 1:54013783-54013805 CTTGAAGGCAGGCACTGTGTTGG + Intronic
907788075 1:57633540-57633562 TGGGAAGGGAGGGACAGAGTGGG + Intronic
908252260 1:62274499-62274521 GGTGAAGGCAGTGTCTGTGATGG - Exonic
909203582 1:72725280-72725302 TGTGTAGGGAGGGAGTGGGTGGG - Intergenic
911252806 1:95597323-95597345 TATAAGGGCAGGGACTGTGTTGG - Intergenic
913282853 1:117202061-117202083 TGTAATAGCAGGTACTGTGTGGG - Intronic
913567612 1:120088559-120088581 TGTGAGGGGAGGGAGAGTGTCGG - Intergenic
913583321 1:120248911-120248933 TGGGAAGGCAGGCCCAGTGTTGG + Intergenic
913624851 1:120649411-120649433 TGGGAAGGCAGGCCCAGTGTTGG - Intergenic
914288360 1:146249267-146249289 TGTGAGGGGAGGGAGAGTGTCGG - Intergenic
914549397 1:148700013-148700035 TGTGAGGGGAGGGAGAGTGTCGG - Intergenic
914565309 1:148860747-148860769 TGGGAAGGCAGGCCCAGTGTTGG + Intronic
914607516 1:149269501-149269523 TGGGAAGGCAGGCCCAGTGTTGG - Intergenic
914617287 1:149371705-149371727 TGTGAGGGGAGGGAGAGTGTCGG + Intergenic
914647033 1:149663145-149663167 TGTGGAGGCAGGGGGTGTATGGG - Intergenic
914917964 1:151829948-151829970 TGTGAAGGCAGGGACTGTGTTGG + Intronic
915295164 1:154915575-154915597 TGGGAAAGCAGGGATTGAGTAGG + Intergenic
919485735 1:198145124-198145146 TGTGGAGGGAGGGACTCGGTGGG - Intergenic
920071613 1:203306477-203306499 TCAGAAGGCAGGGTCTGTGTGGG - Intronic
920265037 1:204715434-204715456 TGGGAAGGGAGCGTCTGTGTGGG + Intergenic
920448847 1:206041715-206041737 TATGATTGCAGGCACTGTGTGGG + Intronic
920544297 1:206802721-206802743 AGGGAAGGGAGGGACAGTGTTGG - Intronic
923300981 1:232640535-232640557 TGTGAAGGCAGGAAGTGTGCAGG + Intergenic
924270339 1:242325767-242325789 TGGGATGGCAGGGAAGGTGTAGG - Intronic
924496256 1:244592889-244592911 TGAGAAGACAGGGAATGTGGGGG + Intronic
1063218309 10:3943710-3943732 TGTGCAGGCAGTCACAGTGTTGG + Intergenic
1063665276 10:8056951-8056973 TGTCAAGGCAGGCTCTGAGTAGG - Intronic
1064007346 10:11709191-11709213 GGAGAAGGCAGGGACTGCTTAGG + Intergenic
1064094189 10:12410997-12411019 TGTGAAGACAGGAAGAGTGTAGG - Intronic
1064133401 10:12730101-12730123 GGTGAAAGCAGGGAGAGTGTTGG + Intronic
1064164491 10:12974556-12974578 TCTGAAGGCAGGGGATGTGTGGG + Intronic
1064547477 10:16465254-16465276 TGCTAAGGTAGGCACTGTGTTGG + Intronic
1065603316 10:27391771-27391793 TGTCAAGGCAGTGACAGTGGAGG + Intergenic
1066555562 10:36608954-36608976 TGTGACTGCAGGGACAGGGTTGG + Intergenic
1066714592 10:38273034-38273056 TGGGATGGCAGGGAAGGTGTAGG + Intergenic
1067987587 10:51167199-51167221 CGTGGAGGCAATGACTGTGTGGG + Intronic
1068689709 10:59903382-59903404 TGTGAAGGCAGGGGTTACGTGGG + Intronic
1068780611 10:60915806-60915828 TGTGTGGGCAGGGAGTGTGGAGG - Intronic
1069789593 10:71011208-71011230 TGTGGAGGGAGGGACCTTGTGGG - Intergenic
1070438600 10:76418983-76419005 TGTCAAGGCAGGGAGTATCTGGG - Intronic
1070675742 10:78410217-78410239 AGGGAAGGCAGGGACTGAGATGG - Intergenic
1070678574 10:78433122-78433144 TCTGCAGTCAGGCACTGTGTGGG - Intergenic
1072501265 10:96020329-96020351 TTTAAAGACAGGGACTGTGGTGG + Intronic
1073456186 10:103638112-103638134 CATGAAGGCAGGGGCTGTGTGGG - Intronic
1073703918 10:105960800-105960822 TCTGAAGGCAGGGAATGTTGAGG - Intergenic
1074111809 10:110428192-110428214 TGTAAAGGCAGGGTGTGAGTTGG - Intergenic
1074477490 10:113785775-113785797 TGTGAGTGCAGGGAAGGTGTTGG - Intergenic
1074575742 10:114667673-114667695 TGTGAGGGCAGGGATTGACTGGG - Intronic
1075632051 10:124006407-124006429 TGTGGAGACAGGGATTATGTGGG - Intergenic
1076506995 10:130984854-130984876 GGTGCAGGTAGGGGCTGTGTGGG - Intergenic
1076514487 10:131036188-131036210 TGCGAAGGCAGGGACACTGGGGG - Intergenic
1076812953 10:132898657-132898679 TCTTAAGGCAGGGACTGTGCTGG + Intronic
1077056139 11:594210-594232 TGTGAAGGAAGGGCCTGGGCTGG + Intronic
1077139165 11:1016006-1016028 GGAGAAGGCAGGGGCGGTGTGGG + Exonic
1077869798 11:6252092-6252114 TGTTTGGGCAGGGAATGTGTGGG + Intergenic
1078390842 11:10934155-10934177 TGTGAAGGGAGGGAATGGGAAGG + Intergenic
1078518633 11:12046290-12046312 TGTGGAGGAAGGGACTTGGTAGG + Intergenic
1078549840 11:12272440-12272462 CTTGAAGGCAGGGATTGTGGTGG + Intergenic
1079237645 11:18701319-18701341 TCTGAGGCCAGGGACTGTGAGGG + Intronic
1079380205 11:19931482-19931504 AGTGAAGGCAGCCCCTGTGTGGG - Intronic
1081123043 11:39289816-39289838 TTTGAAGAAAGGGAATGTGTGGG - Intergenic
1082847455 11:57738210-57738232 TGTAGAGGTAGGGAATGTGTTGG + Intronic
1082900230 11:58241145-58241167 TGTGAAGTCAGGTAATGTGATGG + Intergenic
1084575650 11:69986346-69986368 CGAGAGGGGAGGGACTGTGTCGG + Intergenic
1084748377 11:71188071-71188093 TGTGGTGGCAAGGACTGTGTGGG - Intronic
1084927880 11:72528266-72528288 TGAGAATGCAGGGAGTGGGTGGG + Intergenic
1085017482 11:73185017-73185039 TGTAAAAGCAGAAACTGTGTTGG - Intergenic
1085875875 11:80405446-80405468 TGTCATGGGAGGGACTGGGTGGG + Intergenic
1087869562 11:103275245-103275267 TGTGGAGGCAAGGAATGTATGGG - Intronic
1088049796 11:105498363-105498385 TGTGGTGGGAGGGACTGTGGGGG + Intergenic
1088569198 11:111204866-111204888 TTAGAGGGCAGGGACTGGGTTGG + Intergenic
1088830035 11:113529105-113529127 TCAGAAGGCAGGAACTGTGTGGG - Intergenic
1089272012 11:117307851-117307873 TGTGGTGGCAGGGACTGGGTAGG + Intronic
1090080462 11:123609061-123609083 TGTGAGGGGAGGGACAGGGTAGG - Intronic
1090428004 11:126623442-126623464 TTTGAAGGAAGGAACTATGTTGG + Intronic
1091010979 11:132000169-132000191 GGGAAAGGCAGGGACTGTCTGGG - Intronic
1091222930 11:133940933-133940955 CGGGCAGGCAGGGGCTGTGTCGG - Intronic
1091352436 11:134907891-134907913 GTTGAAGGCAGGGACTGTGGAGG + Intergenic
1091515822 12:1180628-1180650 TGTCAAGGCAGTGTCAGTGTTGG - Exonic
1091603805 12:1934004-1934026 TGTGGAGGCAGAGAATGTGGTGG + Intergenic
1092075680 12:5671472-5671494 TGCAAAGGAAGGAACTGTGTGGG + Intronic
1092076042 12:5674391-5674413 TGTGGAGGTAATGACTGTGTTGG - Intronic
1092616478 12:10220231-10220253 TGGCAAGTCAGGGACTGTGTGGG + Intronic
1093047909 12:14471779-14471801 TGTGGTGGGAGGGACTGGGTGGG - Intronic
1095114355 12:38334110-38334132 TGTGTGGGCAGGCAGTGTGTGGG - Intergenic
1096842438 12:54387938-54387960 TGGGGAGGCAGGAACTGAGTAGG + Intronic
1096878143 12:54646248-54646270 TGAGAAGGCAGGGAGGGTGCAGG + Intronic
1098049539 12:66438879-66438901 TATGAAATCAGGGACTTTGTGGG - Intronic
1098184740 12:67884074-67884096 AGTGAAACCAGGCACTGTGTTGG + Intergenic
1098998655 12:77150787-77150809 TGTTATGGCAGGAACTGTGGAGG + Intergenic
1099436829 12:82656024-82656046 TGTGAAAGCAGGGAGAGTGAAGG - Intergenic
1099832928 12:87868363-87868385 TGTGGGGGCAGGGAGTGTATGGG + Intergenic
1101476579 12:105055153-105055175 TGTGCAGGCAGGAAGTGTGAAGG + Intronic
1101600179 12:106202682-106202704 TGTCAAGGCAGGGACTTAGTGGG + Intergenic
1101814286 12:108134011-108134033 TGGGAAGATAGGGACTGTGGTGG + Intronic
1101962102 12:109258298-109258320 TGTGGAGACACGGACTGTGGAGG + Exonic
1101973846 12:109337656-109337678 TGTGATGGGAGGGACCCTGTGGG - Intergenic
1102765156 12:115426611-115426633 TGTGATGCCAGGGACTCTTTGGG + Intergenic
1103191681 12:119006949-119006971 TGAGAAGGCAGGGCCTGCTTGGG + Intronic
1103219743 12:119233700-119233722 TGTAAATGAAGGGACTGGGTGGG - Intergenic
1104146413 12:126038088-126038110 TGTCATGGGAGGGACTGGGTGGG - Intergenic
1104438851 12:128778739-128778761 TGTCATGGGAGGGACTCTGTGGG - Intergenic
1105213717 13:18272632-18272654 AGTGCAGGCAGGGGCTGTGAGGG - Intergenic
1106267422 13:28122942-28122964 GGTTAAGGCAGGGGCTGGGTGGG + Intergenic
1108147671 13:47496732-47496754 TGTGGAGGCAGGGGCTATATGGG + Intergenic
1108157540 13:47601546-47601568 TGTGAAGGCAGGGATGGGGAGGG - Intergenic
1109493354 13:63132814-63132836 TGTGAGGCCTGGGACTGTGTGGG - Intergenic
1110342681 13:74411780-74411802 TGTCATGGGAGGGACTCTGTGGG + Intergenic
1110846939 13:80200813-80200835 TGTGAAGGCAGACCCTGTCTTGG - Intergenic
1110854638 13:80283013-80283035 AGTGAAGACAGGGATTGTGGTGG - Intergenic
1111268323 13:85849455-85849477 TGTCATGGGAAGGACTGTGTAGG - Intergenic
1111362797 13:87197302-87197324 TGTGAAGCTTGGGATTGTGTGGG + Intergenic
1111546648 13:89746795-89746817 TGTCAAGGCAGGGACTTGGTGGG - Intergenic
1111557221 13:89896300-89896322 TGTAAAGGCAGGAACTGGGAGGG - Intergenic
1111708564 13:91782571-91782593 TGTCAAGGGAGGGACTTGGTGGG - Intronic
1111751631 13:92338977-92338999 TGTGAAGGCAGGAGGTATGTGGG + Intronic
1112106620 13:96247351-96247373 TGTCAAGGGAGGGACCTTGTGGG + Intronic
1112956153 13:105060544-105060566 TGAGGAGGCAGGGACTATATGGG - Intergenic
1114538117 14:23435854-23435876 TGTTATGGCATGGACTGTGCAGG + Intergenic
1114614097 14:24059261-24059283 AGTGACTGCAGGGACTGTGTGGG - Exonic
1117442423 14:55772455-55772477 TGTGAAGGCCAGATCTGTGTTGG + Intergenic
1118060038 14:62126389-62126411 ACTGAATTCAGGGACTGTGTAGG + Intergenic
1118359770 14:65045919-65045941 GGTCAAGGCAGAGACTGTGCAGG - Intronic
1118843180 14:69527712-69527734 TGGGAAGGGAGGGACTGGCTGGG + Intronic
1119197945 14:72731527-72731549 AGTGAACACAGGGACTGTGCAGG - Intronic
1119546976 14:75479174-75479196 CCTGAAGGCAGGGATTTTGTTGG - Intergenic
1119963062 14:78881885-78881907 TGTGATGGGAGGGACTGTTGTGG - Intronic
1120582975 14:86277385-86277407 TGTTAAGGAAGGGACCCTGTGGG - Intergenic
1120919932 14:89745391-89745413 TAAGAAGGGAGGGACTGTGCTGG + Intergenic
1121914085 14:97820420-97820442 TGTGATGGGAGGGGCTGTGATGG - Intergenic
1123586122 15:21762124-21762146 TGTGGAGGTAATGACTGTGTTGG + Intergenic
1123622763 15:22204714-22204736 TGTGGAGGTAATGACTGTGTTGG + Intergenic
1124402550 15:29362147-29362169 TGTGAAGGTAGAGACTGAGTGGG - Intronic
1125012201 15:34890705-34890727 TAAGAAGGCAGTGAGTGTGTTGG + Intronic
1125317131 15:38442799-38442821 TGTTAAGGGAGGGACTTGGTGGG + Intergenic
1125415375 15:39447120-39447142 TGTGCAGGTAGGGGCTGGGTAGG - Intergenic
1125430487 15:39588630-39588652 TTTGGAGGCAAGGACTGCGTTGG + Exonic
1126570417 15:50144591-50144613 TGTCAAGGGAGGGACTTGGTGGG - Intronic
1127831671 15:62756496-62756518 TTTGAAGGCTGGGGCTGTGGAGG - Intronic
1128259004 15:66218699-66218721 TGGGAAGCCAGGGCCTGTTTTGG + Intronic
1128328212 15:66738839-66738861 GGTGGAGGCCGAGACTGTGTAGG + Intronic
1129269720 15:74413176-74413198 TGTGAAGGCAGTGGCTGGGGTGG - Intronic
1129296591 15:74603436-74603458 AGTGAAGGCAGGGCCTGGGCCGG - Intronic
1129771193 15:78204515-78204537 TGTCCAGGCAGGGGCTGGGTGGG + Intronic
1130668658 15:85891066-85891088 TGGGAAGGGATGGACTGTGGGGG - Intergenic
1130956129 15:88628794-88628816 TGTGAGTGCAGGGACCATGTTGG - Intronic
1131611210 15:93966194-93966216 TGTGGAGGCAGGTACTATATGGG - Intergenic
1131878715 15:96839195-96839217 TCTGAAGTCAGGGACAGTCTTGG + Intergenic
1132645970 16:999442-999464 TGTGAGGGGTGGGACTGCGTGGG + Intergenic
1134192653 16:12134534-12134556 TGGGAAGTCAGCTACTGTGTTGG - Intronic
1135808213 16:25563785-25563807 TGTTGAGGGAGGGACTTTGTGGG + Intergenic
1135845387 16:25913845-25913867 TGTGGAGGGAGGGTGTGTGTGGG + Intronic
1135943765 16:26845684-26845706 TGAGAATGCAGGGTCTGTGCAGG - Intergenic
1135957041 16:26964491-26964513 TGTTGAGGGAGGGACTTTGTGGG - Intergenic
1136623894 16:31449694-31449716 TTTGAAGACAGGGACTGGCTGGG + Intergenic
1138554365 16:57763161-57763183 TGTGGGGGCAGGGACTGTTTGGG + Intronic
1139382030 16:66538589-66538611 TGTGAAGGCAGAGGCTGGGCTGG - Intronic
1139915965 16:70428662-70428684 TGAGAAGGCAGGGGACGTGTGGG - Intronic
1140592062 16:76365291-76365313 TTTGAAGTCAGGTACTGTGATGG + Intronic
1140607106 16:76552254-76552276 TGTCAAGGGAGGGACCCTGTGGG - Intronic
1141314663 16:82950412-82950434 TGTTATGGGAGGGACTGGGTGGG + Intronic
1141978854 16:87536882-87536904 TGTTGAGGGAGGGACTGGGTGGG + Intergenic
1142958132 17:3535084-3535106 TCTTAAGGCAGGGACAGTGTGGG + Intronic
1143444849 17:7001632-7001654 TCTGAGGGCAGGAACAGTGTTGG - Exonic
1143482344 17:7234822-7234844 AGTGAAGGTGGGGACTGTGGGGG + Intergenic
1143536178 17:7541382-7541404 TGTGATGGCTCGGACTGTCTGGG - Intergenic
1143947298 17:10604614-10604636 TATGAAGGCAGGGAGTATATGGG - Intergenic
1144408116 17:14972484-14972506 TGTGCAGGGAGGGTCTGTGCAGG + Intergenic
1144445157 17:15320700-15320722 TGTCAAGGCAGGGAGAATGTTGG - Intronic
1145078832 17:19877501-19877523 AGTGGGGGCAGGGAGTGTGTGGG + Intergenic
1146004024 17:29149494-29149516 TGCCAATGCAGGGACTGGGTGGG - Intronic
1146123989 17:30217857-30217879 TGTGAAGGGAGGGACGGGCTTGG + Intronic
1147143460 17:38472263-38472285 TGTCAAGCCAGGGCCCGTGTGGG - Intronic
1147155745 17:38543801-38543823 GGTGAGGGCGGGGACTGTGGGGG - Exonic
1147390067 17:40103627-40103649 TGTGAAGGCAGAGGCTGGGAGGG + Intergenic
1147661235 17:42118148-42118170 AGAGAAGGCAGGGACTGGGGGGG + Intronic
1148329736 17:46806697-46806719 TCCGAAGTCAGGGACTGGGTGGG + Intronic
1149369581 17:55979569-55979591 TGTGGAGGAAGGGACCTTGTGGG - Intergenic
1150519222 17:65848864-65848886 TGAGAAGGCAGTGAGAGTGTCGG - Intronic
1150822785 17:68449318-68449340 TGTGAAGGCAGGCACTGTGCTGG - Intronic
1151350708 17:73530457-73530479 TGTCGAGGGAGGGACTTTGTGGG - Intronic
1151698135 17:75728468-75728490 TGAGAAGTAAGTGACTGTGTGGG + Exonic
1152037837 17:77884156-77884178 TGTGACGGCAGGGACTTGGGAGG - Intergenic
1152185726 17:78855367-78855389 TGCCAAGGCAGGGACTGGGAGGG + Exonic
1152473473 17:80503219-80503241 TGTGAAGGGAGGGACCTGGTAGG + Intergenic
1155275754 18:24185686-24185708 TGTGGGGCCAGGGAGTGTGTGGG + Intronic
1156446168 18:37238513-37238535 TGTGTGGGCATGGAGTGTGTAGG - Intergenic
1156950581 18:42891984-42892006 TGTGAGGGCAGGGGGTGTGTGGG + Intronic
1156998812 18:43499412-43499434 TAAGAAGGGAGTGACTGTGTTGG + Intergenic
1157441213 18:47713127-47713149 TGTGAAGACAGGGGCTGAGCAGG - Intergenic
1158130071 18:54142653-54142675 TGTCAAGGGAGGGACCTTGTGGG + Intergenic
1159146822 18:64465375-64465397 TGTGGAGGCAGGGAGTATATAGG - Intergenic
1161393947 19:4034917-4034939 TCTGAAGGCAGGGTCTGGGACGG - Intronic
1163102988 19:15108836-15108858 TGGGATGCCAGGGACTGAGTAGG + Intronic
1163523037 19:17803340-17803362 AGTGAGGGCAGAGATTGTGTGGG + Intronic
1164029697 19:21392374-21392396 TGGGAAGAAAGGGACTGTTTGGG + Intergenic
1164037565 19:21467826-21467848 TGTGGGGGTAGGGGCTGTGTGGG + Intronic
1164231403 19:23291130-23291152 TATGAGGGCAGGGACTCAGTCGG - Intergenic
1164814630 19:31185815-31185837 TGGGAAGGCAGGCACTGACTGGG - Intergenic
1165283059 19:34814497-34814519 TGTGGAGGGAGGGACTTGGTGGG + Intergenic
1166074207 19:40404320-40404342 TGTAAGGGGAGGGACTGCGTCGG + Intronic
1167746791 19:51356357-51356379 TGTGTAGGCAGGGTCAGTATTGG - Exonic
1168078693 19:53993827-53993849 TGTGGGGGCAGGGACTTTGGGGG - Intronic
925296576 2:2781119-2781141 TGTGAAGCCTGGGAGGGTGTAGG - Intergenic
925943187 2:8838955-8838977 TGTCAAGGGAGGGACTTGGTCGG - Intergenic
926120571 2:10239330-10239352 TGTGGAGGAAGGGACTTTATGGG - Intergenic
926546068 2:14241743-14241765 TGTGAAAGCATGGACAATGTTGG + Intergenic
926592587 2:14755717-14755739 TGTAGAGGCAGAGAGTGTGTGGG + Intergenic
926604072 2:14878705-14878727 TGTGAAGGCAGGGAGTATGTGGG - Intergenic
926641804 2:15245251-15245273 TGTGAAGGCAGGGAGGGGATAGG - Intronic
928178719 2:29052846-29052868 TGTGGAAGCAGGGAAGGTGTTGG + Exonic
928318948 2:30268305-30268327 TGTGAAGGCAGAGACTGTATGGG + Intronic
928740072 2:34341255-34341277 TGTCAAGGGAGGGACTTGGTAGG - Intergenic
929211412 2:39360850-39360872 TGTTATGGGAGGGACTTTGTGGG - Intronic
929714922 2:44300330-44300352 TCTGAAGACATGGACAGTGTGGG + Intronic
931216015 2:60245571-60245593 TGTTAAGGGAGGGACCTTGTGGG - Intergenic
931669031 2:64630391-64630413 AGTGAAGGCAGAGACTGGGGCGG - Intergenic
932498511 2:72159804-72159826 TGTGGTGGCAGGGACTGGGGAGG + Intergenic
933161493 2:79028715-79028737 TGTGTGGGCAGTGAGTGTGTGGG - Intergenic
933966362 2:87432573-87432595 GGTGAGGGCAGGCACTGAGTGGG + Intergenic
933967725 2:87443526-87443548 TGGGATGGGAGGGACTGTGTTGG + Intergenic
934300609 2:91774117-91774139 AGTGCAGGCAGGGGCTGTGAGGG + Intergenic
935474892 2:103507041-103507063 TGTCAAGGGAGAGACCGTGTGGG + Intergenic
936326074 2:111506970-111506992 TGGGATGGGAGGGACTGTGTTGG - Intergenic
936327433 2:111517912-111517934 GGTGAGGGCAGGCACTGAGTGGG - Intergenic
937024041 2:118682731-118682753 GGGAGAGGCAGGGACTGTGTTGG - Intergenic
937742246 2:125368929-125368951 TGTCAAGGGAGGGACTTGGTAGG - Intergenic
938146662 2:128839984-128840006 TGTAGAGGCAGGGACTTGGTAGG - Intergenic
938591493 2:132741060-132741082 TATAAAGGCATGGTCTGTGTGGG - Intronic
938823715 2:134983614-134983636 GGTGGAGGGAGGGACTGTGGGGG + Intronic
940053636 2:149490574-149490596 TCTGAGGGGAGGGGCTGTGTGGG - Intergenic
942256129 2:174100298-174100320 TGTGAAGACAAGGACAATGTCGG - Intronic
942389012 2:175472666-175472688 TGTGAAGGCAGAAACTGAGATGG - Intergenic
942603673 2:177667615-177667637 TGTGAAGCACAGGACTGTGTGGG - Intronic
942776723 2:179590660-179590682 TGTCAAGGGAGGGACCTTGTGGG + Intronic
942875565 2:180792329-180792351 TGTGAGGACAGTGACTGTGTTGG - Intergenic
943514666 2:188869526-188869548 TCTGAAGGCAGAGATTGTCTTGG + Intergenic
944536550 2:200716202-200716224 TGTGAGGGAAGGGACTTTGCAGG + Intergenic
945166790 2:206954960-206954982 TGTCATGGGAGGGACTCTGTGGG - Intronic
945307565 2:208273150-208273172 TATGAAGGCAGGGATTTTTTGGG - Intronic
945973094 2:216249549-216249571 TGTCAAGGCAGGGACCTGGTGGG - Intergenic
946196187 2:218034110-218034132 CATAAAGGCAGGGACTCTGTCGG - Intergenic
946586356 2:221192092-221192114 TGTGAAGGCAGGGAGTATGTGGG + Intergenic
946936185 2:224723196-224723218 TGTGAATGCAGGGACTTCCTTGG + Intergenic
946964883 2:225027195-225027217 TGTGCAGGCGAGGTCTGTGTAGG - Intronic
948230440 2:236345278-236345300 TGTGAAGGAAGGGACGTGGTGGG - Intronic
1171014603 20:21528817-21528839 AGTGAAGGAAGGGTCTGTTTGGG + Intergenic
1172008334 20:31832205-31832227 TGCCAAGGCAGGGACGGTGGAGG - Intronic
1172227642 20:33315862-33315884 TCTGCAGGCAGGGGCTGTCTGGG - Intergenic
1172254611 20:33506220-33506242 TGTAGAGACAGGGTCTGTGTTGG - Intronic
1172876740 20:38169066-38169088 TGGGAAAGCAGGGCCTGTGCTGG + Intergenic
1172940925 20:38654014-38654036 CATGAAGGCAGAGACTATGTGGG + Intergenic
1174264605 20:49322290-49322312 TGTGGAGGCAGGGAGAGAGTGGG + Intergenic
1175698446 20:61120229-61120251 TGTGGGGGCTGGGACTATGTAGG + Intergenic
1175728908 20:61339267-61339289 TGTGGAGGAAGGGACTGGGATGG + Intronic
1175892420 20:62321561-62321583 AGTGGAGGCAGGGCCTGTGGAGG + Intronic
1176125650 20:63473378-63473400 TGTGCAGGGAGGGTCTGTGGAGG + Intergenic
1176303790 21:5113110-5113132 CGTGGGGGCAGGGAGTGTGTGGG + Intergenic
1178144970 21:29728727-29728749 TATGAAGGCAAGGAATGTATCGG - Intronic
1178806240 21:35841886-35841908 TGTGGAGGGAGGGACTTGGTAGG + Intronic
1179140094 21:38717818-38717840 TGTCAAGTCAGTGACTGTATGGG + Intergenic
1179730829 21:43366388-43366410 TGTGGGGGCAGGGAGTGTATGGG + Intergenic
1179793569 21:43769422-43769444 TGTGTAGACAGGGTCTGGGTGGG - Intergenic
1179842235 21:44084714-44084736 TGGGAAGGGGGGGACTGTCTTGG - Intronic
1179853240 21:44148840-44148862 CGTGGGGGCAGGGAGTGTGTGGG - Intergenic
1179916914 21:44483617-44483639 TTTGAGGGCAGCCACTGTGTGGG - Intergenic
1180715914 22:17872200-17872222 CGTGGAGGCAGTGACTGTGGCGG - Intronic
1181202740 22:21227355-21227377 AGTGCAGGCAGGGGCTGTGAGGG - Intronic
1181547538 22:23610621-23610643 TGTGGATGCAGAGACTGTGGTGG - Intronic
1181678690 22:24475701-24475723 TGTGGAGGCAGGGGGTCTGTGGG - Intergenic
1181698964 22:24609250-24609272 AGTGCAGGCAGGGGCTGTGAGGG + Intronic
1184220101 22:43094520-43094542 TGGGAAGTCAGGGCCTGTGGTGG - Intergenic
1203224176 22_KI270731v1_random:68058-68080 AGTGCAGGCAGGGGCTGTGAGGG + Intergenic
950138035 3:10596317-10596339 TATGAGGGCAGGGACTCTGTGGG + Intronic
950547984 3:13650099-13650121 TGTAGGGGCAGGGAGTGTGTGGG + Intergenic
950838792 3:15947002-15947024 TGTCATGGGAGGGACTGGGTGGG + Intergenic
951562511 3:23982409-23982431 TGTGAGGGCAGGGCCAGTGAGGG + Intergenic
952296126 3:32063638-32063660 TGTGAAGGGAGGGACCTGGTGGG + Intronic
952893273 3:38058809-38058831 TGTGCATGCAGGGGCTGTATGGG + Intronic
952962104 3:38598784-38598806 AGAGAAGGCTGGGACAGTGTGGG + Intronic
953002255 3:38946639-38946661 GCTGCAGGCAGGGACTGTGCTGG - Intronic
953928908 3:46996389-46996411 TGTGGAGGCTGGGACTGACTGGG - Exonic
954686175 3:52371482-52371504 TGTGCAGGCGGGGACAGTGTTGG + Intronic
955611606 3:60763493-60763515 TGTGAAGGTAGGTACTATTTTGG + Intronic
955654628 3:61231701-61231723 TGTGAAGGGAAGAACTGAGTTGG - Intronic
956279818 3:67544317-67544339 TGTGAAGGGAGGGACCTAGTGGG + Intronic
956794090 3:72702561-72702583 TGTGACAGTTGGGACTGTGTGGG + Intergenic
957238805 3:77630497-77630519 TGTCAAGGGGGGGACTTTGTGGG - Intronic
957760567 3:84549784-84549806 TGTGGTGGGAGGGACTCTGTGGG + Intergenic
957765889 3:84622962-84622984 TGTCATGGGAGGGACTCTGTAGG - Intergenic
958460680 3:94390780-94390802 TTTGAAGTCAGGTACTGTGATGG - Intergenic
958504016 3:94949976-94949998 TGTGAAGTCAGGTGCTGTGATGG + Intergenic
958704299 3:97634509-97634531 TGTGCACGCAGGAACTTTGTTGG + Intronic
959213289 3:103417285-103417307 TGTGAAGACAAGGGCTATGTTGG - Intergenic
959405175 3:105952864-105952886 TGTGGAGGGAGGGACTGGGTGGG - Intergenic
961167950 3:124776504-124776526 TGTGAAGGTAGGATCTGGGTGGG - Intronic
961537890 3:127580922-127580944 GGTGAAGCCAGGGACAGGGTGGG + Intronic
961557109 3:127703259-127703281 TGAGAAGGCAGAGAATGTGGTGG - Intronic
961853017 3:129840590-129840612 TGTCAAGGGAGGGACTTGGTGGG + Intronic
962755682 3:138464102-138464124 TTTGGAGGCAGGGAGTGTGGAGG + Intronic
962878415 3:139553738-139553760 GGTGACAGCAGGGGCTGTGTTGG - Intergenic
963867022 3:150372670-150372692 TGGGAAGGATGGGACTGTGGGGG - Intergenic
964092457 3:152892705-152892727 TGTGATGGGAGGGGCTGTCTTGG + Intergenic
964638782 3:158886081-158886103 TATGAAGTCAGGGATTATGTTGG + Intergenic
964763405 3:160155749-160155771 CATGAAGGCAGGGACTTTGCCGG - Intergenic
964826947 3:160839030-160839052 TGAGAAGGCAAGTAGTGTGTAGG - Intronic
964912789 3:161802262-161802284 TGTTATGGCAGGGACCCTGTGGG - Intergenic
965046390 3:163584098-163584120 TGTCAAGGTAGGGACTGAGTGGG - Intergenic
966714409 3:183000964-183000986 TGTGAGGGAAGGCACTGAGTGGG - Intergenic
967495329 3:190137230-190137252 TGTGAGGGCAGGGAGTATTTGGG + Intergenic
967582614 3:191178141-191178163 TGTGGTGGGAGGGACTGAGTGGG - Intergenic
968323994 3:197796215-197796237 TGTCAGGGCAGGGAGTGTCTTGG - Intronic
968731771 4:2272449-2272471 GGAGAAGGCAGGGACTGGTTAGG - Intronic
968873593 4:3253881-3253903 TGTGAGGGTGGGGTCTGTGTGGG - Intronic
968920518 4:3519998-3520020 TGTTAAGGCGGGGGCTGTGAGGG - Intronic
969226495 4:5801867-5801889 TGGGGAGGCAGGGACTGGATGGG + Intronic
969250361 4:5964162-5964184 GGTGAAGGCAGGGTCTGTGCAGG + Intronic
969696094 4:8735691-8735713 GGTGAAGGAAGGCCCTGTGTAGG - Intergenic
970962159 4:21884825-21884847 AGGGAAGGCAGTGACTGTGGTGG - Intronic
972122639 4:35724793-35724815 TGGGAAGTCAGGGACTATATGGG - Intergenic
972374248 4:38456096-38456118 TGTGAGGGCCTGGACTGGGTTGG + Intergenic
972961876 4:44462672-44462694 TGTGAAGGGAGGGACATGGTGGG + Intergenic
973210024 4:47605281-47605303 TGTGAAGGCAGGGATTTGGCTGG + Intronic
973303045 4:48611437-48611459 TATGAAGGCCCTGACTGTGTGGG + Intronic
973345049 4:49046541-49046563 TGAGAAGGCAGGGTGTGTGGGGG + Intronic
974219355 4:58947075-58947097 TGTCAAGGGAGGGACCTTGTGGG - Intergenic
976812085 4:89108987-89109009 TGTGGGGGCAGGGAGTATGTGGG - Intronic
978354860 4:107861038-107861060 TGTGAGGCCAGGGACTAGGTCGG + Intronic
979021714 4:115508854-115508876 AGTGAAGGCATGGATTTTGTAGG + Intergenic
980757866 4:137190006-137190028 TGTCAAGGGAGGAACTATGTGGG - Intergenic
982797400 4:159663005-159663027 TGTCAAGGGAGGGACTTGGTGGG - Intergenic
983089674 4:163488490-163488512 TGTCAAGGGAGGGACTTGGTGGG - Intergenic
983379474 4:166973052-166973074 TGTTAAGGAAGGGACTTGGTGGG + Intronic
983861705 4:172715252-172715274 TGTGGCGGCAGGGTGTGTGTGGG + Intronic
983908070 4:173205699-173205721 TCTGAAGTCTGGGGCTGTGTAGG + Intronic
984906919 4:184636923-184636945 TGTGAAAGCCGGGACTGTGAGGG + Intronic
986141166 5:5031786-5031808 TGTCAAGGGAGGGACCTTGTGGG + Intergenic
986687436 5:10286950-10286972 TGTGAAGTCAGAGAGTGTCTGGG - Intronic
986757663 5:10853404-10853426 TGTAAGGCCAGGGACTATGTGGG - Intergenic
987166615 5:15204573-15204595 TGTCAAGGGAGGGACTTAGTGGG + Intergenic
987257222 5:16168514-16168536 TGTGAAAGCAAAGACTGTTTAGG + Intronic
987518042 5:18940371-18940393 TGTAGAGGCAGGGAATATGTGGG + Intergenic
987879900 5:23729920-23729942 GGTGAAGTCAGGAACTGTGAAGG - Intergenic
988014546 5:25536744-25536766 TGTCATGGGAGGGACCGTGTGGG - Intergenic
988270071 5:29002671-29002693 TGTCAAGGAAGGGACTCGGTGGG + Intergenic
988571559 5:32372385-32372407 TGTGAGGGCAGGGGATATGTGGG + Intronic
990026889 5:51203100-51203122 TGTCAAGGAAGGGACTTGGTTGG + Intergenic
991628469 5:68629555-68629577 TAATAAGACAGGGACTGTGTTGG - Intergenic
992416186 5:76553849-76553871 AGTGAATGCAAGGACAGTGTTGG + Intronic
993198587 5:84782431-84782453 TGTGATGGGAGGGGCTGTCTGGG + Intergenic
993311437 5:86337958-86337980 AGTGTAGGGAGGGAATGTGTGGG - Intergenic
994549016 5:101207466-101207488 TGTCAAGGGAGGGACTTAGTGGG + Intergenic
994549267 5:101209459-101209481 TGTTAAGGCAGGGACCAGGTAGG + Intergenic
994920401 5:106035257-106035279 TGTCAAGGGAGGGACTCTGTGGG - Intergenic
996095560 5:119395304-119395326 TGTGAAGGCTGAGAATGTGATGG + Intronic
997611132 5:135216484-135216506 TGGGAAAGCAGGAATTGTGTTGG + Intronic
997743625 5:136279426-136279448 GGTGAAGGCAGGAGCTGTGGCGG + Intronic
998893067 5:146767636-146767658 TGTGGAAGCAGGGAGTGTATGGG - Intronic
999461098 5:151758278-151758300 TGTGTACGCAGGGAAGGTGTGGG + Intronic
1000293670 5:159894152-159894174 TGTGAAGGAAGGCACTGAATGGG - Intergenic
1000536280 5:162482320-162482342 TTTGAATGCAGTGACTGTGTGGG - Intergenic
1000580945 5:163035013-163035035 TGTGAGGGGAGGGGCTGTGTGGG - Intergenic
1001052643 5:168425295-168425317 TGTGAAGGTCAGGACTGAGTAGG + Intronic
1002064162 5:176643834-176643856 TGTGAGGGCTGGGGCTTTGTGGG + Intronic
1002463234 5:179387332-179387354 AGTGAGGGCAGGGGCTGTGTGGG - Intergenic
1003204685 6:3997052-3997074 TATGAAGGGAGAGACTGTTTTGG - Intergenic
1004294755 6:14400459-14400481 GGTGATGGCAGGGACTGGGTAGG - Intergenic
1006474949 6:34247620-34247642 TGCTAAGGCAGGGGCTGGGTGGG - Intronic
1006729741 6:36228024-36228046 TCTGGAAGCAGGGGCTGTGTAGG + Intronic
1006808822 6:36806720-36806742 GGTGGAGGCAGGGGCTGTCTTGG - Intronic
1006825124 6:36929117-36929139 TGTGAATGCAAGGACAGTGCTGG - Intergenic
1007251536 6:40498472-40498494 TGTGAAGGCAGCCACAGTGCAGG - Intronic
1008021747 6:46586404-46586426 TATGAAGTCAGGGACCATGTTGG + Intronic
1011113544 6:83865129-83865151 TATGAGGGCAGGGACATTGTTGG + Intronic
1011629640 6:89311488-89311510 TCTGAGGGCCGAGACTGTGTGGG - Intronic
1013885424 6:114959112-114959134 TGTCAAGGGAGGGACTCAGTGGG + Intergenic
1014326692 6:120005595-120005617 TGTGGAGGGAGGGACCTTGTGGG + Intergenic
1015577641 6:134690035-134690057 TGGGAAGGAAGGGACTGTGGAGG - Intergenic
1016401647 6:143687970-143687992 TTTGTGGGCAGGGTCTGTGTAGG - Intronic
1017796519 6:157849780-157849802 AGAGAAGGCAGGGTCTGTGCTGG + Intronic
1017834847 6:158168111-158168133 CGTGAAGGCAGGGGTGGTGTGGG - Intronic
1018420373 6:163635799-163635821 TGAGAAGTCAGGGAGTGTGGGGG + Intergenic
1020520588 7:9180971-9180993 TCTGAGGACAGAGACTGTGTAGG + Intergenic
1020736048 7:11950346-11950368 AGTGAAGGGAGGGACTGGGTGGG + Intergenic
1023971484 7:44994471-44994493 TTTGAAGGTACGGACTATGTGGG - Intergenic
1025093028 7:56078573-56078595 TGTGAAGGTAGGGACACTCTGGG - Intronic
1025719594 7:63998093-63998115 TGTCAGGGCAGGGACCGGGTGGG - Intergenic
1025721456 7:64019550-64019572 TGTCAAGGGAGGGACTTGGTGGG + Intergenic
1025743488 7:64222347-64222369 TGTTAAGGGAGGGACTTGGTGGG + Intronic
1025748613 7:64270776-64270798 TGTCAAGGAAGGGACTTGGTGGG + Intergenic
1027397515 7:77771361-77771383 CATGATGGCAGGGACTTTGTTGG + Intronic
1027816226 7:82975732-82975754 TGTGGAGGGAGGGACTTGGTGGG + Intronic
1028881150 7:95881289-95881311 TGTGAAGGTACTAACTGTGTAGG + Intronic
1029140305 7:98404724-98404746 TGTGCAGGCAGGGAGTCTGCTGG + Intergenic
1029172084 7:98637948-98637970 TGTCAAGGCTGGGATTGTGCAGG + Intergenic
1029314373 7:99698026-99698048 TGTCAAGGCAGAGGCTGTGCTGG + Intronic
1029320013 7:99750518-99750540 TGTCAAGGCAGAGGCTGTGCTGG + Intergenic
1031338760 7:120572272-120572294 TGTGAAAGAAGTGAATGTGTAGG + Intronic
1031532255 7:122888950-122888972 TGTGGAGGGAGGGACTTGGTGGG + Intergenic
1033221403 7:139528614-139528636 TGTCATGGGAGGGACTGGGTGGG - Intronic
1033458432 7:141523267-141523289 TGTGGAGCCAGAGACAGTGTGGG + Intergenic
1033905581 7:146198097-146198119 TGTGTAGGGAGGGACTTGGTGGG - Intronic
1033958232 7:146878987-146879009 TGTGAGGGAAAGGACTGTCTGGG + Intronic
1033985070 7:147215074-147215096 TGTTGAGGCAGGGACTTGGTGGG - Intronic
1034589980 7:152130847-152130869 TGTGAGGGAAGGGACTATGACGG + Intergenic
1036986196 8:13533750-13533772 TGTGGAGGGAGGGACTTGGTTGG + Intergenic
1037108873 8:15142252-15142274 TGTTTAGGCAGGCACTGAGTAGG + Intronic
1037326210 8:17693793-17693815 TGTGAAGGCAGGGTCCATGTGGG + Intronic
1037747271 8:21656088-21656110 TTTAAAGGCAGGGACTGGCTAGG + Intergenic
1038113804 8:24529991-24530013 TGTGAAAGCAGTCATTGTGTTGG - Intergenic
1038478432 8:27885141-27885163 TGAGAGGGCAGGTACTGTCTTGG + Intronic
1039378094 8:37057660-37057682 TGTCAAGGGAGGGACCCTGTGGG + Intergenic
1039910699 8:41824840-41824862 CGTGAAGGCAGGGGGTGTGGAGG + Intronic
1040947059 8:52894850-52894872 TCTGAAGGAAGGGAGTGTATTGG + Intergenic
1042106679 8:65335029-65335051 TGTGAGGGAAGGGCCTGGGTTGG - Intergenic
1042749844 8:72146789-72146811 TGACAAGGCATGGCCTGTGTTGG + Intergenic
1043237156 8:77882145-77882167 TGTGAAGGGAGGGACCTGGTGGG - Intergenic
1043482227 8:80664948-80664970 GGTGAAGCCAGGGACTGGGAAGG + Exonic
1043523703 8:81073808-81073830 TGTGGAGGTAGGGACTGCCTGGG + Intronic
1044730837 8:95227344-95227366 GTTGAAGGCAAGGCCTGTGTGGG - Intergenic
1045672635 8:104573392-104573414 TCTGAAGGCAGGAGCTGTGTGGG - Intronic
1045753715 8:105516350-105516372 TGGGAAGGCAGTGTGTGTGTTGG + Intronic
1046065615 8:109193665-109193687 TGTGAAGGCAGGGCATATATAGG - Intergenic
1048027415 8:130599415-130599437 TGTGTGGGGAGGGTCTGTGTTGG - Intergenic
1049448135 8:142641094-142641116 AGGGAAGCCAGGGACTCTGTGGG - Intergenic
1050120575 9:2303227-2303249 TGTCATGGGAGGGACTCTGTGGG - Intergenic
1051779227 9:20670621-20670643 TGTCAAGGGAGGGACTTGGTGGG - Intronic
1052027556 9:23590414-23590436 AGTGGAGGCAGGGAAAGTGTAGG + Intergenic
1053274021 9:36770061-36770083 TCTGGAGGCAGGGGCTGTGCCGG + Intergenic
1053289957 9:36873279-36873301 CCTGAGGGCAGGGGCTGTGTCGG + Intronic
1055121616 9:72666674-72666696 TGGGAAGGCAGGGGCTTTGTTGG - Intronic
1055250126 9:74293805-74293827 TCTGAAGGCAGGGGCAGTCTTGG - Intergenic
1055413919 9:76062947-76062969 TGGGAAGGGTAGGACTGTGTGGG - Intronic
1055455869 9:76471050-76471072 GGTGAATACAAGGACTGTGTTGG - Intronic
1057151093 9:92796667-92796689 TGTGGAAGCAGAGGCTGTGTGGG - Intergenic
1057550356 9:96047617-96047639 GGTGAGGGCAGGGACTGGGCAGG - Intergenic
1058199227 9:102018136-102018158 TGTGATGGCAGTCACAGTGTGGG - Intergenic
1058464938 9:105217681-105217703 TGTCATGGCAGGGACAGAGTGGG - Intergenic
1058627925 9:106954417-106954439 TGTCAAGGAAGGGACCTTGTGGG - Intronic
1059446120 9:114339111-114339133 TGTAAAAGTAGGGACTGTCTGGG + Intronic
1061595810 9:131628502-131628524 TGGGAAGGCAGGGAGGGGGTGGG - Intronic
1061838365 9:133343626-133343648 TGTGGAGGCAGGGACAGTCATGG - Intronic
1185875136 X:3695936-3695958 TGAAAAGGCAGGCACTGGGTAGG - Intronic
1185959165 X:4528417-4528439 TTTGGAGGTAGGAACTGTGTTGG + Intergenic
1187171572 X:16857130-16857152 GGGGAAGGCAGGGAATGAGTGGG + Intronic
1187462734 X:19502290-19502312 TGTGGAGGGAGGGACTTGGTGGG + Intronic
1189326705 X:40116636-40116658 CGTGATGGCAGGGGCTGTGACGG - Intronic
1190759994 X:53431191-53431213 TGTGAAGGCTGTGACAGGGTTGG - Intergenic
1191962267 X:66716588-66716610 AGGAAAGGCAGGGACTATGTAGG - Intergenic
1192477196 X:71453217-71453239 TGTGAGGGCAGGGAGTATATGGG - Intronic
1192788294 X:74355126-74355148 TGTGAAGTCTGGGCCTGTGGGGG - Intergenic
1193331405 X:80238996-80239018 TGTTATGGGAGGGACTCTGTTGG - Intergenic
1193481210 X:82031849-82031871 TGTGAAGGCAGAGTATGTATAGG - Intergenic
1194841861 X:98753369-98753391 TGTCAAGGGAGGGACCTTGTGGG - Intergenic
1195456125 X:105072064-105072086 TGTCAAGGGAGGGACTGGGTGGG + Intronic
1195634401 X:107097400-107097422 TGTCAAGGGAGGGACTTAGTGGG + Intronic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1197181773 X:123544430-123544452 TTTGGAGGCAGAGGCTGTGTAGG - Intergenic
1197451756 X:126628462-126628484 TGTGCTGGGAGGGACTTTGTGGG - Intergenic
1197703828 X:129619444-129619466 TTTGAGGGAAGGGAATGTGTAGG - Intergenic
1197921707 X:131601617-131601639 TGTCAAGGAAGGGACTTAGTGGG - Intergenic
1198154560 X:133946097-133946119 TCTAAAGGCAGGTACTGTGGGGG - Intronic
1198595353 X:138229967-138229989 TGAGAAGGCAGGTGCTGGGTGGG - Intergenic
1198801413 X:140451714-140451736 TGTGAAAGGAGGGACTGTGTTGG - Intergenic
1199494786 X:148441127-148441149 TGTGAAGACTGGGGCTGTGCAGG - Intergenic
1199987691 X:152964256-152964278 CGTGAAGGCCGGGCCTGTGAGGG + Intronic
1199995360 X:153021251-153021273 TCTGAATTCAAGGACTGTGTGGG + Intergenic
1200424677 Y:3008019-3008041 TGAGAAGTCAGGAACTGTGGAGG - Intergenic