ID: 914919484

View in Genome Browser
Species Human (GRCh38)
Location 1:151837975-151837997
Sequence GCTGCTGCCCCCGCTGGGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 328}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914919484 Original CRISPR GCTGCTGCCCCCGCTGGGTG GGG (reversed) Exonic
900104237 1:975506-975528 GCAGCAGCCCCTGCAGGGTGGGG - Exonic
900124873 1:1064830-1064852 GCAGCTGCCCTCGGTGGGAGGGG + Intergenic
900207097 1:1436225-1436247 GCTGGTGCCCTGGCTTGGTGGGG + Intronic
900237776 1:1600725-1600747 GCAGCTGCCTCCGCTGCGTGTGG - Intergenic
900333520 1:2149156-2149178 ACGGCTTCCCCCGCAGGGTGTGG - Intronic
900513916 1:3072481-3072503 GCTGCAGCCCCCACTAGATGGGG + Intronic
900786165 1:4652059-4652081 GCTGCTGCCCCGGGTGAGTGAGG - Intergenic
900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG + Intronic
900997027 1:6128308-6128330 GCTGCAGCCCCTGCTGGGGATGG - Intronic
901047353 1:6405219-6405241 GCTCCGGCCTCTGCTGGGTGGGG - Intergenic
901088380 1:6625593-6625615 GCTGCAGCCCCCGCCGCGCGCGG + Intronic
901889417 1:12249907-12249929 ACTGCAGACCCCGCTGGGTAAGG + Intronic
902683278 1:18058771-18058793 GCAGCTGCCCGGGCTGGGTTGGG - Intergenic
903059686 1:20661284-20661306 GCTGCTGCCCTTGCTTGGCGCGG - Exonic
903115525 1:21176265-21176287 GCTGCTGCCGCCGCCGGGTGAGG + Exonic
903115673 1:21176685-21176707 CCTCCTGCCCCCGCCGGGTCCGG - Intronic
903389405 1:22953540-22953562 GCTGGTGCCCCCGCTGCGTCTGG - Exonic
903620738 1:24696206-24696228 TGTGCTGCCCTCTCTGGGTGTGG + Intergenic
903971636 1:27122683-27122705 GGTGCTGCCCCAGCTTGGAGTGG - Intronic
904498717 1:30902123-30902145 CCTGTTGCCCCAGCTGGCTGAGG - Intronic
904684204 1:32248778-32248800 TCTGCTGACCCAGCTGGGAGGGG + Exonic
905243352 1:36595709-36595731 GCTGCAGCCCCCGCTGCAGGAGG + Intergenic
906345214 1:45010577-45010599 GCTGCTGCTGCCGCTGGAGGTGG + Exonic
907252115 1:53146429-53146451 GCAGCTGATCCAGCTGGGTGTGG + Intergenic
907559544 1:55375834-55375856 TCTGCTGCCCCCTATTGGTGTGG - Intergenic
910429027 1:87143042-87143064 GCAGCTTCACCCGCTGTGTGAGG - Intronic
911527396 1:99004205-99004227 GCTGAAGCCACCGCGGGGTGTGG + Intronic
913328355 1:117647135-117647157 AGTCCTGCCCCCGCTGCGTGTGG + Intergenic
913581698 1:120233273-120233295 GCTGCTTCCCCTCCCGGGTGAGG + Intergenic
913626479 1:120665115-120665137 GCTGCTTCCCCTCCCGGGTGAGG - Intergenic
914563629 1:148844720-148844742 GCTGCTTCCCCTCCCGGGTGAGG + Intronic
914609198 1:149285506-149285528 GCTGCTTCCCCTCCCGGGTGAGG - Intergenic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
915105621 1:153533603-153533625 TCTTCTGTCCCCACTGGGTGGGG - Intergenic
915191662 1:154155937-154155959 CCTGTTGCTCCAGCTGGGTGCGG + Intronic
915280377 1:154818376-154818398 GCTGCTGGCCCCCCTGGGAGAGG - Intronic
916578581 1:166088400-166088422 TCTGCAGACCCTGCTGGGTGGGG + Intronic
918309410 1:183275033-183275055 GTTCCTGCCCCAGGTGGGTGTGG + Intronic
919739058 1:200971733-200971755 GGTGCTGGCCCTGCTGGATGTGG - Intronic
919820388 1:201468669-201468691 GCTGCAGCCCGCGTTCGGTGAGG + Exonic
920342597 1:205284822-205284844 GCTCCTGCTCCCTCTGGGGGAGG - Intergenic
922605343 1:226886729-226886751 TCTGCTGCCCCCGCTGGAAGGGG - Intronic
922764992 1:228152016-228152038 GCTGTAGCCCCCTCTGAGTGAGG + Intronic
922808106 1:228401059-228401081 GGTGCTGCCCCGGCTGCGGGAGG - Exonic
923216611 1:231854017-231854039 GCTGCTCACCCACCTGGGTGGGG + Intronic
923355404 1:233150084-233150106 GGTCCTGGCCCCGCTGGCTGTGG - Intronic
1065596655 10:27319832-27319854 GCCGCTGTCCCCGCTGGCTGCGG - Intergenic
1066109374 10:32182653-32182675 GCTGCTGCCCCGGGTGGGTGGGG + Intergenic
1067226905 10:44382544-44382566 GCAGCCGCCCCCGCTGGGATGGG + Intronic
1067750178 10:48966538-48966560 GCTGCAGTCCTGGCTGGGTGAGG - Exonic
1067806226 10:49395295-49395317 GCTGCGCCCCCCGCAGGGCGGGG + Intronic
1068858226 10:61819418-61819440 CCTGCTGCCCCCACAGAGTGTGG + Intergenic
1070637921 10:78143976-78143998 GATGCTGGCCCTGCTGGCTGGGG + Intergenic
1071575896 10:86726088-86726110 CCCGCTGCCCCCACTGGGTGCGG + Intronic
1073094643 10:100972162-100972184 GCAGCTGCCCCTGCTGCCTGCGG - Intronic
1073540722 10:104314762-104314784 GCTGCTGAGCCCGCTGGGACCGG + Exonic
1073680717 10:105700617-105700639 GCTTCTGCCACTGCTGGGAGAGG + Intergenic
1075211025 10:120491123-120491145 GCTGCTGGCCCTGCTGGGTGAGG + Intronic
1075472640 10:122704425-122704447 GCTGCTGCCACCGCTGGCCCAGG - Intergenic
1076598369 10:131639804-131639826 ACTGTTGCCCCTGCTGGGTAGGG - Intergenic
1076736572 10:132461780-132461802 GCAGCCGCCCCAGCAGGGTGGGG + Intergenic
1076783912 10:132739587-132739609 GCTGCGTCCCCCTCTGGGAGTGG - Intronic
1076798976 10:132811968-132811990 GCTGATGGCCCCACTGTGTGGGG - Intronic
1076899549 10:133330838-133330860 GCTGCTGTCCTTGCTGGGTTAGG - Intronic
1077030235 11:462215-462237 GCTCCTGGCCCCTCTGGGTCTGG - Intronic
1077164074 11:1127297-1127319 GCTGCACCCCACGCTGGGTGAGG + Intergenic
1077231511 11:1459962-1459984 GCTGCTGGCCCCACTGCATGAGG - Intronic
1077413112 11:2412667-2412689 GGTCCTGCCCTCGCAGGGTGGGG - Intronic
1077600231 11:3569550-3569572 GCTGCAGCCCCCGCTGAGCTGGG - Intergenic
1077674410 11:4183825-4183847 GCTGCTGTCACCGCTGGGGCTGG - Intergenic
1078085395 11:8230599-8230621 TCTGCTGCCCCCTCTAGGTTTGG + Intronic
1078406411 11:11073969-11073991 GCTGCTGCCTCACATGGGTGAGG + Intergenic
1078850401 11:15157965-15157987 GCTGCTGCCCTCGCTGAGATAGG - Intronic
1079690033 11:23406342-23406364 GCTGCTGCCCCTGCTGGACCAGG - Intergenic
1080879105 11:36302493-36302515 GATGCTGGCTCAGCTGGGTGCGG + Intronic
1081639947 11:44746162-44746184 GCAGCTGCCCCCCGTGGGTGGGG + Intronic
1082986071 11:59172332-59172354 GCTGCTGCCGCTGCTCTGTGGGG - Intronic
1083222797 11:61264568-61264590 TCTGCTTCCCCAGCTGGGAGAGG - Exonic
1084592554 11:70099003-70099025 TCTTCTGCCCCCTCTGGTTGGGG + Intronic
1084949522 11:72657093-72657115 GCTGCTGACCCTGATGAGTGGGG - Intronic
1085792369 11:79507093-79507115 GCTGCTGCCTCCTCTGTCTGTGG + Intergenic
1087006751 11:93479069-93479091 GGTGCTGCCCACGCTGGCCGTGG - Exonic
1087159684 11:94936511-94936533 GCTCCTGCTCCCACTGGGCGTGG + Intergenic
1090807626 11:130212226-130212248 ACTGGTGGGCCCGCTGGGTGGGG + Intergenic
1096121656 12:49092678-49092700 GCTGCTGCCCCCGCAGGTCAGGG - Intronic
1097192304 12:57225384-57225406 GCTGGGGCCCCCGCTGGGGATGG + Exonic
1099202135 12:79690104-79690126 GCTGCTGCCCCCTCCCGGGGGGG + Exonic
1100444821 12:94650586-94650608 GCCGCCGCCGCCGCGGGGTGGGG + Intergenic
1102394605 12:112575365-112575387 GCTGCAGCACGCGCTGGCTGGGG + Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1103833337 12:123798367-123798389 GCTCCTGCTCCCACTGTGTGAGG - Intronic
1103889527 12:124228215-124228237 GCTGCCACTCCCGCTGTGTGGGG + Intronic
1105407364 13:20143359-20143381 GCTGCCGCCGCCCATGGGTGCGG - Intronic
1105471043 13:20694931-20694953 ACTGCAGCCCAGGCTGGGTGAGG + Intergenic
1105504578 13:20998804-20998826 GCTGCGGCCCCCGCCCCGTGTGG - Intronic
1105512393 13:21061438-21061460 GCTGCTGGCCCCGCAGGGACGGG + Exonic
1105601588 13:21892835-21892857 GCTGCTGCCGCATCTGTGTGGGG + Intergenic
1105978534 13:25495161-25495183 GCTGCTGCCCTTCCAGGGTGGGG + Intronic
1106524360 13:30527097-30527119 GCTGCGGCCCCTGCTCTGTGAGG - Intronic
1106583053 13:31034071-31034093 GCTGCTGCTCACGCTGGAAGGGG - Intergenic
1112305254 13:98267698-98267720 GCGGCTGCGCCTGCAGGGTGAGG - Intronic
1113716890 13:112516373-112516395 CCTCCAGCCCCCACTGGGTGCGG - Intronic
1113941166 13:114019236-114019258 GCTGCTGACACTGCTGGGTGTGG - Intronic
1114198872 14:20504871-20504893 GCTGCTGTCCTTGCTGGGTTAGG - Intergenic
1114221246 14:20699410-20699432 GCTGCTGACCCTGCTGGGGCTGG + Exonic
1115202999 14:30874187-30874209 GCTCCAGGCCTCGCTGGGTGGGG + Intergenic
1115486757 14:33917804-33917826 GCTGCAGCCAGGGCTGGGTGTGG - Intergenic
1116798088 14:49413205-49413227 GCTGCTCCCCACCCTGAGTGAGG - Intergenic
1117119618 14:52553209-52553231 TCCGCTGCCCCCGCCGGGCGTGG - Exonic
1117402325 14:55369691-55369713 ACTGCTGCTCGCGATGGGTGGGG + Exonic
1118709064 14:68504965-68504987 GCTGCTGCCCATGTTTGGTGTGG - Intronic
1118750904 14:68807350-68807372 TCTGCTGCAGCTGCTGGGTGAGG + Intergenic
1118820877 14:69345041-69345063 GCAGCTGCCCCCTCTGAGTGGGG - Intronic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1119670698 14:76516006-76516028 GCTGCTCCCCACGCTGGGATGGG - Intergenic
1119821051 14:77616535-77616557 GCTGCTGCCGCCGCACGGTGCGG - Exonic
1121051403 14:90821076-90821098 GCTGTTGCCCCGGCAGGGTGAGG - Intergenic
1121616707 14:95318685-95318707 GCTGCTTCCCCTGCTGGCTTGGG - Intronic
1121786127 14:96662418-96662440 GCTGCTGCCCCATTTGGGAGAGG + Intergenic
1121792595 14:96710280-96710302 GCTGCAGCCCTCTCAGGGTGTGG + Intergenic
1122126666 14:99582102-99582124 CCCCCCGCCCCCGCTGGGTGTGG - Intronic
1122132462 14:99612795-99612817 GCAGCTGCACCCTCTGGGTCAGG + Intergenic
1122155933 14:99750400-99750422 ACTGTGGCCCCAGCTGGGTGAGG - Intronic
1122480127 14:102041784-102041806 GCTGCTGCCACCTGTGGCTGGGG - Intronic
1124655961 15:31507616-31507638 GTTGCTGCCGCTGCTGGCTGGGG + Intronic
1125725420 15:41866016-41866038 GGTGTAGCCCCAGCTGGGTGGGG - Exonic
1127428369 15:58878023-58878045 GCTGCTGCCCATGATGGTTGAGG + Intronic
1127789916 15:62390559-62390581 GCTGCCGCCGCCGCTGGCTCCGG - Intronic
1128112666 15:65086489-65086511 GCTGGTGCCCCCTCTGGTGGAGG + Intergenic
1128153501 15:65377686-65377708 GCTGCTGCCCGCGCCGAGCGAGG - Exonic
1128551359 15:68599979-68600001 GCTGCTGTCCCTGCTGCTTGGGG + Intronic
1128989901 15:72250954-72250976 GCTGCTGCCCAGGGTGGGGGTGG + Exonic
1129389708 15:75214460-75214482 CCTGCTGCCCCAGCTGGTGGTGG + Intergenic
1129517189 15:76163828-76163850 GCTGCTGCCACCACTGCCTGAGG - Intronic
1129705261 15:77790684-77790706 GCTGGGCCCCCCGCTGGGTTTGG + Intronic
1130061811 15:80575798-80575820 GCTGCGGCACCTGCTGGGTGAGG + Intronic
1130090084 15:80813634-80813656 ACTGCTGCTCCGGCCGGGTGTGG - Intronic
1130247174 15:82262604-82262626 GCTGCTGCAGCCGGTGAGTGTGG - Exonic
1132149046 15:99446948-99446970 ACTCCTGCCCCCGCTGGGTAAGG - Intergenic
1132563376 16:609176-609198 GGTGCTGCCACGGCTGGGTGAGG + Intronic
1132579392 16:678148-678170 GCTGCTGTGCCCCTTGGGTGTGG + Exonic
1132594141 16:740599-740621 TCTGCTGCCTCCTCTGGGTTGGG + Intronic
1133008001 16:2895278-2895300 GGCGCTGCCCTGGCTGGGTGGGG - Exonic
1133221101 16:4319524-4319546 CCTGCTGCCAGCCCTGGGTGTGG + Intronic
1133234757 16:4382632-4382654 GCTCCTGGCCGCGCTGGCTGCGG + Exonic
1133241227 16:4415863-4415885 GATGCTGCCACGGCTGGGTGGGG - Intronic
1133689889 16:8203292-8203314 GCTGCTGCCCTCGCTGGAGCAGG - Intergenic
1134452188 16:14370340-14370362 GCTGCTGACCAGGCTGGGCGTGG + Intergenic
1135712549 16:24729905-24729927 GCTGCCGCCGCCGCGGGTTGCGG - Intronic
1136414741 16:30096224-30096246 GCTGCTGCCGCCGCTGCGGCGGG + Intronic
1136566431 16:31073400-31073422 GCTGCTGGCCCGGCGCGGTGTGG - Intronic
1136572622 16:31105799-31105821 GCTGCTGCCCCCGGCGGCGGAGG - Intergenic
1137028611 16:35501712-35501734 GGTGCTGCCCTGGCTGGGTAAGG - Intergenic
1138452787 16:57103706-57103728 GCTGCTGGGCCGGCTGGGTGGGG - Intronic
1139582099 16:67879857-67879879 GCTGCTGCTGCTGCTGGGAGAGG - Exonic
1141098419 16:81179416-81179438 GCTGATGCCCTGGCTGGGTATGG + Intergenic
1142345039 16:89548501-89548523 GCTGCTGCCGCCCGTGGCTGTGG + Intronic
1142958285 17:3535547-3535569 GGTGCCGCCCCCGCCCGGTGCGG - Intronic
1143443921 17:6996231-6996253 GCTGCGGCCCGCGCGGGGCGAGG + Exonic
1143527711 17:7482104-7482126 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1143635552 17:8162322-8162344 CCTGCTGCCCCGGCTGGGGAGGG - Exonic
1143637869 17:8176686-8176708 GCTGTTGCCCACGCCGGGAGCGG + Intergenic
1144180170 17:12744368-12744390 GCTGCTGCTGCTGCTGGCTGAGG - Exonic
1145815868 17:27794467-27794489 GCTGCTGCCCCATCTGGGTCTGG - Intronic
1145861845 17:28217706-28217728 TCTGTTGCCCAGGCTGGGTGCGG + Intergenic
1146731047 17:35194166-35194188 GCTGGTGGCCCTGCTGGGTGGGG - Exonic
1147446251 17:40476990-40477012 GCTGCAGGCCAAGCTGGGTGTGG - Exonic
1147948491 17:44093703-44093725 GTTGCTGCTCCCGCAGTGTGGGG + Exonic
1147971292 17:44220065-44220087 GCTGCTGCCGCCGCCGGGGAAGG + Intronic
1148034135 17:44645509-44645531 GGTGCTGCCCACGCTGGCCGCGG + Intergenic
1148114164 17:45165147-45165169 GCTGTTGCCCCAGCTGGGACAGG - Intronic
1148699400 17:49578742-49578764 GCTGCTGGCCCCGCCTGGGGAGG + Exonic
1149567405 17:57649921-57649943 GCTGCTGCCCGTGCTGTGTGAGG + Intronic
1150281710 17:63932738-63932760 GCTCCTCTTCCCGCTGGGTGAGG - Intergenic
1150339405 17:64354402-64354424 GCTGCTGCCCAGGATGGGAGGGG - Intronic
1151363114 17:73600419-73600441 GCTTCTGCCTCCCCTGGGGGAGG + Intronic
1151490716 17:74431154-74431176 GCTGCTGGCCTCGCGGGGGGTGG - Exonic
1151815194 17:76468311-76468333 CCTGCTGCCCACGGTGGGAGGGG - Intronic
1152097100 17:78278671-78278693 GCTGCTGCACCTGTTGGGTGTGG - Intergenic
1152323769 17:79623909-79623931 GCTGCTGGCTCCGCAGGGTGAGG + Intergenic
1152587798 17:81196817-81196839 GCTGCTGCGCCTGCAGGGTGTGG + Exonic
1152858402 17:82679868-82679890 GCTGCTGCCCGAGCAGGCTGCGG + Intronic
1152866489 17:82726739-82726761 GCTGCTGCCTGGGCTGGGGGCGG + Intronic
1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG + Intergenic
1154502052 18:15001957-15001979 CGTGCAGCCCCCACTGGGTGCGG - Intergenic
1155982515 18:32196084-32196106 TCTGGTGCCCCCGCTGGCTCGGG + Intronic
1159851022 18:73527430-73527452 ACATCTGCCCCCGCTGGTTGTGG + Intergenic
1160459391 18:79026530-79026552 TCTGCTGCCACGGCAGGGTGGGG - Intergenic
1160766878 19:812710-812732 GGGGCTGCCCCCGCTGGGCGCGG - Exonic
1161079937 19:2305655-2305677 ACTCCTGCCCCCTCTGGGTTTGG - Intronic
1161219907 19:3113726-3113748 GCCGCTGCCCTCCCTGGGTCAGG + Intronic
1161249941 19:3275250-3275272 GCTGGACCCCCTGCTGGGTGGGG - Intronic
1161289086 19:3483262-3483284 GCTGCTGGCCGCGCTGGTGGTGG - Intergenic
1161312023 19:3600121-3600143 CCTGCTGCCCCTGCTGGGCGTGG - Exonic
1161353261 19:3805260-3805282 ACTGCTGGCCCCCCTGGCTGTGG + Exonic
1162262973 19:9547634-9547656 GCTGCTGCCCTTGCTGTGAGAGG + Intergenic
1162904961 19:13817894-13817916 GCTGCTGGCCCTGCTGGAGGAGG + Exonic
1163110908 19:15160697-15160719 GCTGGGGCCCCAGCTGGGTCTGG + Exonic
1163128411 19:15257045-15257067 GCTGCTGCTGTCGCTGGATGAGG + Exonic
1163152336 19:15422818-15422840 GCTGCTGCCCCTGCTGGACCAGG + Exonic
1163586497 19:18167184-18167206 GCTGCTGCTCCAGCTTCGTGCGG - Exonic
1164750921 19:30654185-30654207 GCTGGTGCCCAGGCTGCGTGGGG + Intronic
1165851234 19:38851411-38851433 GGGGCTGCCCGCGCAGGGTGTGG + Intronic
1165861622 19:38912098-38912120 GCGGCTGCTCCTGCTGGGGGCGG - Exonic
1166001120 19:39877973-39877995 GCTGCCGCCCCAGATGGGTATGG + Exonic
1166003905 19:39894232-39894254 GCTGCCGCCCCAGATGGGTATGG + Exonic
1166831927 19:45644508-45644530 GCAGCTGGCCTCTCTGGGTGGGG - Intronic
1167522067 19:49961006-49961028 GCTGCTGCCCGTGCTGGGGGCGG - Exonic
1167523315 19:49969719-49969741 GCTGCTGCCCGTGCTGGGGGCGG + Intergenic
1167581310 19:50344698-50344720 GCTGCTGCCTCTGCTGAATGTGG - Intronic
1167584422 19:50365564-50365586 GCTGCTGCCTCTGCTGAATGTGG - Exonic
1167785210 19:51630299-51630321 GCTGCTGCCCCTGCTGTGGGGGG - Intronic
1167787309 19:51646723-51646745 GCTGCTGCCCCTGCTGTGGGGGG - Exonic
925813382 2:7723597-7723619 CCTGCTGCACCTGCTGGGAGCGG + Intergenic
926305618 2:11635668-11635690 TCACCTGCCCCAGCTGGGTGAGG + Intronic
927653836 2:24928866-24928888 ACTGCTGACCCGGCTGGGCGCGG + Intergenic
928825094 2:35410629-35410651 GCTGCGCCCCCTGCTGGCTGGGG + Intergenic
929438638 2:41948344-41948366 TCAGCTGCCCCTGCTGGCTGGGG + Intronic
930026409 2:47031841-47031863 GCTGCAGCCCAGGCTGTGTGAGG + Intronic
930785671 2:55269315-55269337 GTTGCTGTCGCCGCTGGGGGTGG + Intronic
932412172 2:71553975-71553997 CCTGCTACCCCCGCTGCATGGGG + Intronic
932497505 2:72153635-72153657 CCTGCTGTCCAGGCTGGGTGGGG + Intergenic
933634096 2:84688201-84688223 TCTGTTGCCCAGGCTGGGTGGGG - Intronic
935269706 2:101423365-101423387 GCTGCTGTCCCCTCTGGGCATGG + Intronic
936109656 2:109654536-109654558 GCTGCTGCACTAGATGGGTGTGG - Intergenic
936661344 2:114547316-114547338 GCTGCTGCCCCTGCAGGGTCTGG + Intronic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
941384963 2:164841469-164841491 GCTGCAGCCCCCGCCCCGTGGGG + Intronic
941625024 2:167822023-167822045 GCTGCTTCCTCCACTGTGTGGGG - Intergenic
941844623 2:170120797-170120819 GCTGCTGGCCCCACAGAGTGTGG - Intergenic
942641607 2:178066730-178066752 GCTGCTGCCAGCTCTGGGTGAGG - Intronic
945676247 2:212858663-212858685 GCTCCTGGCCATGCTGGGTGTGG + Intergenic
946157638 2:217817739-217817761 GGTGCTGCCCCCACTGGGACTGG + Exonic
946230258 2:218286894-218286916 GCTCCTGCGCCTGCTGGGTGGGG - Intronic
946827327 2:223692183-223692205 GCTACTGGCCCCGCTCTGTGGGG - Intergenic
947205602 2:227658298-227658320 GCTGCTGCTGCTGCTGGTTGTGG + Intergenic
947740685 2:232483505-232483527 GCTGCTGCACCTGCAGGGTCAGG + Exonic
948412381 2:237774063-237774085 GCTTCTTCTCCCGCTGCGTGGGG - Intronic
948473785 2:238203617-238203639 GCTGCCGCCCGCCCGGGGTGTGG - Exonic
948876294 2:240831631-240831653 GCTGCAGCCGCCTCTCGGTGTGG - Intergenic
1169075972 20:2759980-2760002 GCGGCTGGGCCCGCTGCGTGGGG - Exonic
1172578882 20:36031072-36031094 GCAGCTGCCCCATCTGGATGGGG - Intergenic
1172842278 20:37909170-37909192 GCTGCTCGCCCTCCTGGGTGTGG - Intronic
1173077546 20:39833886-39833908 GATGCTGCCCCAGGTGGGAGAGG - Intergenic
1174869573 20:54170694-54170716 GCTGCTGTCCCTCCTGGGAGGGG + Intronic
1175019195 20:55826398-55826420 GCTGCTGCCCCAGCTCCTTGAGG + Intergenic
1175803119 20:61812342-61812364 GCTGCTGGGCCTGCCGGGTGGGG + Intronic
1175953366 20:62595759-62595781 GCTGCAGCCTCCACTGGGCGAGG + Intergenic
1176217666 20:63955979-63956001 GTCTCTGCCCCCGGTGGGTGGGG - Intronic
1176375602 21:6085624-6085646 TCGGCTGCCCCCGCTGGAAGGGG + Intergenic
1177488007 21:21783646-21783668 GCTGCTGCTGCTGGTGGGTGGGG + Intergenic
1178843269 21:36155653-36155675 GCTGGAGCCACAGCTGGGTGGGG + Intergenic
1179747872 21:43452620-43452642 TCGGCTGCCCCCGCTGGAAGGGG - Intergenic
1180135878 21:45861402-45861424 GCTGTTGCCCCAGCTGGCTGGGG - Intronic
1180179256 21:46110757-46110779 GCTGCTGGCTCCGCAGAGTGGGG - Intronic
1180247437 21:46557609-46557631 GCTGGTGCCCCCGCTGGAGCTGG + Exonic
1181035896 22:20169599-20169621 GCTGCTGCCCCCCAGGGCTGTGG - Intergenic
1181167473 22:20991443-20991465 GCTGGTGCCCGTGCTGGATGGGG + Intronic
1181681632 22:24499562-24499584 CCTGCTGCTCCTGCTGGGGGAGG - Intronic
1181829222 22:25546088-25546110 GCTGCTGGCCCCTCTGTGTCTGG + Intergenic
1181939427 22:26463955-26463977 GGTGCTGTCCCTGCTGGCTGAGG - Exonic
1183050535 22:35257596-35257618 GCTGCTGCCGCCTCAGGGTGGGG - Intronic
1183678509 22:39313155-39313177 CCTGCCCCCCTCGCTGGGTGTGG - Intronic
1183831576 22:40420884-40420906 GCTGCTGCTGCTGCTGGTTGAGG + Exonic
1184333556 22:43840550-43840572 GCTACTGCCCCGGCTTGGAGTGG + Intronic
1184380602 22:44142942-44142964 GCTGCTGCCCCCACAGGGGCGGG - Intronic
1184605973 22:45575120-45575142 GCTGCTGTGCCAGGTGGGTGTGG - Intronic
1184734850 22:46391969-46391991 GAGGCAGCCCCCGTTGGGTGTGG - Intronic
950202884 3:11057312-11057334 GCAGCTGACCCAGCTGGGTCAGG - Intergenic
950956828 3:17062890-17062912 GCTGCTGCCGCCGCTGCTTAGGG - Intronic
953550067 3:43894967-43894989 ACTGCTGTCCCCTATGGGTGTGG - Intergenic
953868922 3:46609453-46609475 GTTCCTGCCCCCACTGGGGGAGG + Intronic
953904071 3:46859469-46859491 CGTGCTGGCCACGCTGGGTGAGG - Exonic
954140362 3:48601857-48601879 GCTGCTGGCCCTGCAGGGGGTGG + Intronic
954369491 3:50162737-50162759 GCTGCTGCCTGGGCTGGGTTTGG + Intronic
955342666 3:58137413-58137435 GCTTCTGCCCAAGCTGGGGGAGG - Intronic
957071059 3:75568201-75568223 GCTGCAGCCCCCGCTGAGCTGGG - Intergenic
960874671 3:122284765-122284787 GCTGCTGCTCTTGCTGGGTTAGG - Exonic
961283056 3:125778523-125778545 GCTGCAGCCCCCGCTGAGCTGGG + Intergenic
961545335 3:127629267-127629289 GCTGCTGCTTCTGCTGGTTGGGG + Exonic
961919628 3:130412390-130412412 GCTGCTAACCACACTGGGTGAGG + Intronic
965205289 3:165713642-165713664 GCTGCAGCCACACCTGGGTGGGG + Intergenic
965665210 3:171086397-171086419 GCTGCTGCCCCAGCTCTATGTGG - Intronic
968549521 4:1214901-1214923 GCTGCAGGCCCCGCTGGGGTTGG - Intronic
968689269 4:1982271-1982293 ACTGATGCCTCCGATGGGTGGGG + Intergenic
968879569 4:3292327-3292349 GCTGCTGCCCGCGCTCCGGGAGG + Intergenic
968915184 4:3494161-3494183 CCTGCTGACCCCACTGGGAGAGG + Exonic
969014658 4:4095899-4095921 GCTGCAGCCCCCGCTGAGCTGGG - Intergenic
969196631 4:5568517-5568539 GCTGCTGGCCCTGCTGGATTCGG - Exonic
972212068 4:36850245-36850267 GCTGCTGCCCCTGATGCCTGGGG - Intergenic
972371172 4:38424723-38424745 GCTGCTGGCCCTGCTGGGGAGGG - Intergenic
974549120 4:63349233-63349255 GCTGCTGCCCGCGCCAGGTGAGG + Intergenic
975006057 4:69287662-69287684 ACTGCTGCCTCCACTGGGAGGGG - Intronic
975560359 4:75703327-75703349 GCTGCTGCCTCCGCAGTGTCTGG - Intronic
975986134 4:80202767-80202789 GCTGCTGGCCCCGCGGCCTGGGG + Exonic
977240333 4:94560761-94560783 GCTGTTGCCCAGGCTGGGTGTGG + Intronic
978146147 4:105374267-105374289 GCTACTTCCACGGCTGGGTGTGG + Intronic
984752906 4:183296130-183296152 GGTGCTGCCATAGCTGGGTGAGG + Intronic
985731914 5:1554076-1554098 GCTGCTGGTCCCGCTGGTGGAGG + Intergenic
986182604 5:5407495-5407517 GCTGCTACCTCTGCTGAGTGAGG + Intergenic
986338407 5:6771053-6771075 GCTGTTGCCTCCACTGGTTGGGG + Intergenic
986826303 5:11526499-11526521 GGTGCTGGCCCAGCTGGCTGAGG + Intronic
991030589 5:62078196-62078218 GCTGCTGGCACCACTGAGTGGGG - Intergenic
993900505 5:93581269-93581291 GCCGCTGCCGCCGCCGGGGGTGG - Intergenic
994722948 5:103401598-103401620 GCTTCTGTCCCCACTGAGTGAGG - Intergenic
996257613 5:121425280-121425302 ACTGATGCCGCCTCTGGGTGAGG - Intergenic
999294484 5:150449958-150449980 GCGGCTACACCCGCGGGGTGAGG + Intergenic
999776022 5:154813880-154813902 GTTGCAGCCCCCCATGGGTGAGG + Exonic
1000276989 5:159746738-159746760 GCTCCTGGCCCCTCTGGGAGTGG + Intergenic
1006100650 6:31684104-31684126 CCTGCTTCCACCCCTGGGTGGGG + Intergenic
1006788940 6:36686282-36686304 GATGATGCCCCCACTCGGTGAGG - Exonic
1010590977 6:77711616-77711638 GCTGCTGGCACAGCTGGGTTTGG + Intronic
1013108519 6:107046662-107046684 GCTGCTGACCCCGAAGGGTCAGG + Intronic
1013155878 6:107490561-107490583 GCTGCTGCCGCCGCCGGCGGTGG - Exonic
1015256382 6:131183687-131183709 GCTGCTGCTCCCCCTGGGGTGGG + Intronic
1016034568 6:139373450-139373472 GCTGCTGCCGCCGCTGTGCTTGG + Exonic
1017871961 6:158494016-158494038 GCTGCAGCACCCGGAGGGTGAGG - Intronic
1018125656 6:160679609-160679631 TCTGCTGCCCCCTGTCGGTGTGG + Intergenic
1018749945 6:166795719-166795741 GCTGCTGCCCCAGCAGGCTCAGG + Intronic
1018763211 6:166908472-166908494 CCTGCTTCCCACGCTGGCTGTGG - Intronic
1018880179 6:167869938-167869960 GCTGCTGCCATCGCTTTGTGTGG + Intronic
1018901526 6:168054142-168054164 GCAGCTCTCCCTGCTGGGTGGGG - Intergenic
1019057248 6:169232482-169232504 GCTGCTCTCCGCGCGGGGTGCGG - Intronic
1019210075 6:170397803-170397825 GCTGTTGGCCCCTCTAGGTGAGG + Intronic
1019452778 7:1108223-1108245 TCTGCTTCCCCCCCGGGGTGCGG - Intronic
1020069209 7:5214708-5214730 AGCGCTGCCCCAGCTGGGTGTGG + Intronic
1021498298 7:21300852-21300874 GCTGCTGCCCCTTCTGGATATGG - Intergenic
1021685880 7:23185145-23185167 TCTGCTGCCCCCCCATGGTGTGG - Exonic
1022355088 7:29607022-29607044 GCTGCTGGCACAGATGGGTGGGG + Intergenic
1022793594 7:33714298-33714320 GCTGGTGCCGCTGCTGGGTGTGG - Intergenic
1022807499 7:33837484-33837506 GTTGCTGCCCCAGCCGGGTGGGG + Intergenic
1023821027 7:43980573-43980595 TGTCCTGTCCCCGCTGGGTGCGG + Intergenic
1023829608 7:44031081-44031103 GCTGCTGCCCCCAGAGGGTGGGG - Intergenic
1024628985 7:51231886-51231908 GCTGCTTCCATGGCTGGGTGGGG - Intronic
1026734913 7:72943229-72943251 GCTGCTGCTCCCGCTGCTGGCGG - Exonic
1026785246 7:73298144-73298166 GCTGCTGCTCCCGCTGCTGGCGG - Intergenic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1026994499 7:74606655-74606677 GCTCCTGCCCCGGCCGGGAGCGG + Intergenic
1027108828 7:75421780-75421802 GCTGCTGCTCCCGCTGCTGGCGG + Exonic
1027328271 7:77065001-77065023 TGTCCTGTCCCCGCTGGGTGCGG - Intergenic
1029739916 7:102485339-102485361 GCTGCTGCCCCCAGAGGGTGGGG - Intronic
1029757913 7:102584518-102584540 GCTGCTGCCCACAGAGGGTGGGG - Intronic
1029775851 7:102683579-102683601 GCTGCTGCCCCCAGAGGGTGGGG - Intergenic
1032019095 7:128396683-128396705 GCTGCTGTCACCACTGGGGGTGG + Exonic
1032192302 7:129772030-129772052 GGTGCGGCCACAGCTGGGTGGGG - Intergenic
1033420138 7:141198345-141198367 GCCGCTGCCACCTCTGGGTGTGG - Intronic
1034192736 7:149224124-149224146 GCTGCTGCCCTGGCGGGCTGCGG + Exonic
1034222805 7:149459552-149459574 GCGGCGGCCGCCCCTGGGTGAGG - Intronic
1034270838 7:149802838-149802860 GCTGCTGCCCAGGCCGGGGGAGG + Intergenic
1034402151 7:150869657-150869679 GCTGCTGCCCACGCAGGATCTGG + Intergenic
1034601619 7:152262458-152262480 GCTTCTGCCCCTTCAGGGTGAGG - Intronic
1034963174 7:155374686-155374708 GCGGCTGCCCCTGCGGGGTTCGG + Intergenic
1035188052 7:157141074-157141096 GCTGCTGCCCCTCCGGGATGAGG + Intronic
1035237396 7:157507687-157507709 CCTGCTGACCCTGCAGGGTGTGG + Intergenic
1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1036807373 8:11844848-11844870 CCTGCTGCCCCAGCTGACTGTGG - Exonic
1036910655 8:12754977-12754999 GCTACTGCCGCCGCTGCCTGCGG - Exonic
1038803743 8:30772046-30772068 GCTGAGTCCCCCTCTGGGTGGGG + Intergenic
1040332987 8:46401728-46401750 GGTGCTCCCCCCTCTGGGTGGGG - Intergenic
1041192277 8:55366016-55366038 GCTGCTGCCTCCCCTGGGCTGGG + Intronic
1043372676 8:79612141-79612163 GCCGCTGTCCCCGCAGGGTTGGG - Intronic
1044591622 8:93917859-93917881 GCTGCTGCCCGCGCGGGTTGTGG + Intronic
1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG + Intronic
1046644168 8:116766726-116766748 GCTGCTCCCGCAGCTGGATGCGG - Exonic
1047615315 8:126558131-126558153 GCTGCCGCCCGCGCCGGGAGAGG - Exonic
1049108405 8:140627907-140627929 GCTGCTGCCCCCACTGTCTCGGG + Intronic
1049454971 8:142682148-142682170 GCTGCAGCCCACACTGGGTGTGG + Exonic
1049585156 8:143429572-143429594 GCTGCTGCACCCGCTTGAAGCGG + Exonic
1049678421 8:143903966-143903988 GCTGCGGGCCCTGCTGGGTGAGG - Intergenic
1049731413 8:144180465-144180487 CCTGCTGCCCGTGCTGGGCGTGG + Exonic
1049798361 8:144506623-144506645 GCAGCTGCCCCCGCGGGCGGTGG + Exonic
1049820901 8:144632611-144632633 CCTGCTGCCCTGTCTGGGTGAGG - Intergenic
1052713327 9:32084983-32085005 TCTGCTGCCTAGGCTGGGTGTGG + Intergenic
1052997659 9:34559744-34559766 GCTCCTGCCACCGCTGGGGGTGG + Intronic
1053509151 9:38672568-38672590 GCAGCTGGCTCTGCTGGGTGTGG - Intergenic
1054812105 9:69443126-69443148 GCTGCTGCTGCTGCTGTGTGGGG - Intronic
1056094927 9:83243083-83243105 GCTGCCGAGCCCACTGGGTGGGG + Intronic
1057206346 9:93175235-93175257 GCTGCACCACCTGCTGGGTGTGG + Intergenic
1061500472 9:130998637-130998659 GCTGCTGCCAGGGCTGGGCGAGG + Intergenic
1061867432 9:133500076-133500098 GCTGCTGCCGGCGCTGACTGCGG + Intergenic
1061970122 9:134040366-134040388 GGAGCTGCCTCAGCTGGGTGAGG + Intronic
1062338186 9:136081741-136081763 GCTGCTGCCGCCACTTGGTGGGG - Intronic
1062346892 9:136119116-136119138 GCTGCTGCCGTCGCTGGGGTGGG + Intergenic
1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG + Intronic
1062688200 9:137827275-137827297 GCTGCTGCCTCGGGTGGGTGGGG - Intronic
1190929430 X:54935145-54935167 AGTGCTGCCCCTGCAGGGTGTGG - Intronic
1192430999 X:71111476-71111498 GCAGCTGCCCCTGCTGGGAGTGG - Exonic
1194467965 X:94256164-94256186 GCTGCAGGCCCTGCTTGGTGAGG - Intergenic
1200122407 X:153797408-153797430 CCTTCTGCCCCCTCTGGGTGTGG - Intronic