ID: 914927950

View in Genome Browser
Species Human (GRCh38)
Location 1:151905650-151905672
Sequence TCCTTTTGTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 14, 2: 33, 3: 49, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914927950 Original CRISPR TCCTTTTGTTGAGGGAGTGC TGG (reversed) Intronic
900240322 1:1614200-1614222 TCCATTTGTTTAGGGATTGGTGG - Intergenic
900781190 1:4618050-4618072 TCCTTATCTTGAGTGGGTGCTGG + Intergenic
901148457 1:7084432-7084454 TCCTTCTGGGGAGGGAGTGGGGG + Intronic
901929495 1:12587926-12587948 TCCTGTTGTTGAGTGAGTGAGGG + Intronic
902063335 1:13663745-13663767 TGCTATTGTAGAGTGAGTGCCGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904420445 1:30387520-30387542 TCCTTTGGTGGAGAGAGTCCAGG - Intergenic
905384671 1:37593835-37593857 GCCTTTTGTAGATCGAGTGCAGG - Exonic
908725064 1:67167099-67167121 TCCTCTTTTTTAGGGGGTGCGGG + Intronic
909012188 1:70347240-70347262 TTATTTTCTTGAGGGAGAGCTGG - Intronic
909742376 1:79045833-79045855 TCCTTATGATACGGGAGTGCTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
917699779 1:177568615-177568637 TCCTTTTGGAGAGGGAGTTTGGG - Intergenic
918362269 1:183771617-183771639 TCCTTTTGATACGTGAGTGCTGG + Intronic
919167123 1:193909663-193909685 TTCTTTTGGTCAGGGAGTGCTGG - Intergenic
919437559 1:197580860-197580882 TCCTTATGTTGAGACAGTACAGG - Intronic
919923544 1:202180326-202180348 ACCTTTTGTTGGGGAAGGGCAGG - Intergenic
924920313 1:248622018-248622040 TCCGTTTCTTGATGGGGTGCGGG + Intergenic
1063008199 10:1994863-1994885 CCGTCTTGTTGGGGGAGTGCAGG - Intergenic
1063708766 10:8456953-8456975 GCCTCTTCTGGAGGGAGTGCTGG + Intergenic
1068134597 10:52939685-52939707 TCTTTTTGATAGGGGAGTGCTGG + Intergenic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1069449098 10:68501841-68501863 TACTTTTGTAGAGGGAGTGAGGG - Intronic
1073390776 10:103174572-103174594 TTCTTTTTTTGAGGGAGTGCTGG - Intronic
1074706950 10:116141575-116141597 TCTTTTTTTTGAGGGGGTGGTGG + Intronic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081731061 11:45371986-45372008 TCTAGTTGTTGAGGAAGTGCTGG - Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1083632007 11:64100619-64100641 TCCTTTGGTTCAGTGAATGCAGG + Intronic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1089905900 11:122038236-122038258 TTCTTTTTTTGACAGAGTGCAGG - Intergenic
1090954554 11:131502830-131502852 TGCTTTTGTTGCCTGAGTGCAGG + Intronic
1091488661 12:914314-914336 TGGTTTTGTTGAGGGGGTTCTGG - Intronic
1091574513 12:1720811-1720833 TCCTTTAGTTTAGGGATTGAGGG - Intronic
1091705678 12:2691505-2691527 TCCTTTTGGTGAGGGCGCGCGGG - Intronic
1091800328 12:3320988-3321010 TCATCTTGTTGAGGGAGGACAGG - Intergenic
1092706296 12:11288896-11288918 TTATTTTGTTGAGGAAGTTCTGG - Intergenic
1092847735 12:12599965-12599987 TCATTTTGTTTATGGAGTGGTGG + Intergenic
1095536055 12:43248984-43249006 TCCATTTGTTAAGAGAGTGATGG - Intergenic
1095833008 12:46607701-46607723 TCCTTTTGTGGACTGACTGCTGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096415508 12:51408794-51408816 TCCTTTTCTTGAGGAACAGCAGG - Intronic
1097101289 12:56591373-56591395 TCCTAGGGGTGAGGGAGTGCGGG + Exonic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097877805 12:64659559-64659581 TCCTATTGCTGAGGGAGGGGAGG + Intronic
1099799190 12:87435728-87435750 TTACTTTGTTGAGTGAGTGCTGG - Intergenic
1100412672 12:94337357-94337379 TCATTTTGTTGAAGCAGTACTGG + Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104751131 12:131239887-131239909 GCTTTCTGTTGAGGGAGGGCTGG - Intergenic
1106659127 13:31780064-31780086 CCCTTTTGGGGAGGGAGAGCAGG - Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1107927602 13:45278423-45278445 TCCTTTTGATGAAGAATTGCTGG + Intronic
1108037437 13:46306244-46306266 TCCTTTTTTTGGGGGGGTGGTGG + Intergenic
1108294572 13:49001065-49001087 GCCTTTTGTTGAGGGAAGTCAGG + Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487355 13:63044527-63044549 TTGTTTTGTTGAGGGAATGAAGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1111613498 13:90635968-90635990 TCCTTCTGTTGAAGGAGTCTAGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1117477966 14:56116914-56116936 TCCCTTTAGTGAAGGAGTGCTGG + Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121218425 14:92266311-92266333 TCCTTTTGTTAAAGGATTTCAGG + Intergenic
1121935729 14:98016884-98016906 TTCTTTTATTGAGGGGGTGGTGG - Intergenic
1122254515 14:100467117-100467139 TCCTTTTGTTGGAGGAGAGAAGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1123986246 15:25648909-25648931 TCCATTTCTTGAGGGCCTGCAGG - Intergenic
1124140806 15:27075728-27075750 TCATTTTGTTGAGGAAGAGGTGG + Intronic
1127963836 15:63909298-63909320 TCCTTTTGTTTAGGAAGCACTGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129145281 15:73641488-73641510 TCCTTGTGTGGAGGGAGAACTGG - Intergenic
1129762294 15:78136878-78136900 TCCTGTTGTTGAGGGAGGAGGGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1131032657 15:89199589-89199611 TCATATTGTTGAGGGAGGGGTGG - Exonic
1131942841 15:97585668-97585690 TCCTTTGGTTGTGGGGGTGGGGG + Intergenic
1140218678 16:73028125-73028147 TCCTTTTTTTGGGGGAGTGTGGG + Intronic
1140377116 16:74453437-74453459 TTCTTTTGGAGAGGGAGGGCAGG + Intronic
1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG + Intergenic
1144244934 17:13353413-13353435 TTCTTCTGTAGAGGCAGTGCTGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146641296 17:34543710-34543732 TGGTTTTGCTGAGGGAGTGGCGG - Intergenic
1146726469 17:35160388-35160410 TCCTTTGGTTTAGGGAGTTGGGG + Intronic
1149180689 17:53932520-53932542 TCCTGGTGTTGAGGGAGGGGTGG + Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1154238197 18:12626039-12626061 TCCTTTTTTTGGGGGGGGGCGGG - Intronic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156636017 18:39030356-39030378 TCATTTTCTTGGGGGAGTACAGG + Intergenic
1157483372 18:48070146-48070168 TGCTTTTGCTGAGTGAGTGAAGG - Intronic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164778017 19:30869491-30869513 CCCTTTTGTTGCAGGAGTGCAGG - Intergenic
1165167502 19:33867079-33867101 TCCTGCTGTGGAGGGAGGGCAGG + Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1167254819 19:48420948-48420970 ACCGTTTGTTGAGGGACTGGTGG + Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1168726373 19:58584595-58584617 TCCTTTCCTTGGGGGAGTGAGGG + Intergenic
925893414 2:8454078-8454100 TGCTTCTGATGAGTGAGTGCCGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
928532497 2:32206801-32206823 TCCTTTTGGGGAGGGGGTTCAGG + Intronic
929291808 2:40201100-40201122 TTTTTTTTTTGAGGGAGTGGGGG - Intronic
931405042 2:61968553-61968575 TCCTTTTCTTGATGGAGGGGAGG + Intronic
931431919 2:62215327-62215349 GCCTCTTGGTGAGGGAGTCCAGG + Intronic
932168254 2:69528355-69528377 ATCTTTTGGTGAGGGTGTGCTGG + Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
934902642 2:98172650-98172672 TCCTATTGATGCGGAAGTGCTGG - Intronic
935855173 2:107265924-107265946 ACCTTTTGTTGAAGGAGGGCAGG + Intergenic
937179486 2:119978094-119978116 TCCTTTACTTGAGGGACTGAGGG + Exonic
938222019 2:129577512-129577534 TCATATTGTTGGAGGAGTGCTGG - Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
941085280 2:161110281-161110303 TCCTCTTTTTAAGGGAATGCTGG - Intergenic
941344001 2:164345019-164345041 TCCTTTATTTCAGGGAGTGTAGG + Intergenic
941842493 2:170101432-170101454 TACTTTTATTTAGGGAGTGCTGG - Intergenic
941999454 2:171631590-171631612 TCCTCTTGTTGCGGGAATGAAGG - Intergenic
943831638 2:192471671-192471693 TCCTTCAGGTGAGTGAGTGCTGG - Intergenic
945218510 2:207460748-207460770 GCCTCTTGTTGTAGGAGTGCAGG + Intergenic
945683785 2:212944628-212944650 TCCATTTGTTCAGTGAGTACCGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1169660696 20:7975450-7975472 TCTTTTTTTTGAGGGAGGGATGG - Intergenic
1170868103 20:20178191-20178213 TCCTTTTGTTTAGTGACTACAGG + Intronic
1171023512 20:21608243-21608265 TCCTGTTGCTGTGTGAGTGCGGG + Intergenic
1173483491 20:43422402-43422424 TCCTTTTTTTGGAGGAGTGGGGG - Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174400032 20:50270985-50271007 TCTTTTTGCTGAGTGTGTGCAGG + Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1176929609 21:14792391-14792413 TGCTTTTATTGTGGGAGTGTGGG + Intergenic
1178453445 21:32726574-32726596 GGTTTTTGTTGAGGGGGTGCAGG - Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1180791213 22:18576717-18576739 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181230525 22:21418597-21418619 TCCTGCTGTTGGGGGAGTGGGGG - Intronic
1181248125 22:21516272-21516294 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1182302872 22:29347772-29347794 TCCTGTTGTGGAGGTTGTGCTGG - Intronic
951975680 3:28505103-28505125 GCCTTTTGTTTAGGGTGGGCTGG + Intronic
952107110 3:30083634-30083656 TCCTTCTGGTGAGGCAGTGCTGG - Intergenic
956012689 3:64848499-64848521 TCATTTTGTTGAGAGGATGCTGG + Intergenic
958487660 3:94732327-94732349 TCCATTTGATGATGGAATGCTGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961357769 3:126349810-126349832 TCCTCTTGGTGAGGGCGGGCAGG - Intronic
963547277 3:146675968-146675990 TTCTTTTATTGAAGGACTGCTGG + Intergenic
964253498 3:154748045-154748067 TGGTTTTGTTGAGGGAGGGATGG - Intergenic
964690554 3:159444879-159444901 ACCTGATGTTGAGGGAGTGAAGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966323264 3:178724801-178724823 CCATTTTGTTGTGGGTGTGCAGG + Intronic
969833980 4:9823910-9823932 TGCTTATGTTGGGGGAGTGAAGG + Intronic
971201477 4:24513147-24513169 TCCTGTTTTGGTGGGAGTGCTGG - Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
973180877 4:47265452-47265474 TCCTTTGGGTGTGGGATTGCTGG + Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
976135427 4:81931057-81931079 TCCATTGGTTGAGGCAGGGCAGG - Intronic
976926080 4:90497891-90497913 TTCTTCTCATGAGGGAGTGCAGG + Intronic
977919031 4:102623904-102623926 TTCATTTGTTGAGGGAATGCTGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
979321941 4:119335142-119335164 CCCTTTTTTTGTGGGAGTGGTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
980663032 4:135891924-135891946 TCTTATTTTTGTGGGAGTGCTGG + Intergenic
980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG + Intergenic
981720833 4:147799902-147799924 TCTTTTTTTTGGGGGGGTGCGGG + Intronic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
985710944 5:1429622-1429644 TCCTTTTGTTTGGGCAGTGTGGG - Intronic
987063128 5:14261692-14261714 TCCTTTGGTTGTGGAGGTGCTGG + Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
990253454 5:53941267-53941289 TCCTTTTTTTAAAGGATTGCAGG - Intronic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993074509 5:83211619-83211641 TTCTTTTGTTGGGGGAGGGGCGG - Intronic
995662351 5:114499533-114499555 GGCGTTTGTTTAGGGAGTGCTGG + Intergenic
996086434 5:119310222-119310244 TCATCTTGTGGAGGGAGTCCAGG - Intronic
996412224 5:123170812-123170834 TGCTTTTGTTGAAGGGCTGCAGG - Exonic
996450018 5:123610393-123610415 TCCTTTGGTTGAGAGACTGTTGG - Intronic
999007671 5:148000756-148000778 TTCTACTGTTGAGAGAGTGCTGG - Intergenic
1000252195 5:159506343-159506365 TGCTTTTGTGGAGGGAGGGAAGG + Intergenic
1000645336 5:163754637-163754659 TCAGTTTGTGGAGGGAGTGTAGG - Intergenic
1001049843 5:168405403-168405425 TTCTTTTTTGGAGGGAGGGCAGG - Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003758626 6:9150230-9150252 TCCATTTGATGATGGAATGCTGG - Intergenic
1004492720 6:16130886-16130908 TCCTTTTGTTGAGGTGGAGGGGG + Intronic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006048410 6:31319424-31319446 ACCTCTTGATGAGGGAGTGGTGG - Intronic
1006626658 6:35402622-35402644 TGGTTTTGTTCAGAGAGTGCTGG - Intronic
1006692938 6:35905681-35905703 TCATATTGTTGGGGTAGTGCTGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007177991 6:39909509-39909531 GCCTTCTGTTTAGGGAGGGCAGG - Intronic
1010391220 6:75340070-75340092 TCCTTTGGGAGAGGAAGTGCTGG - Intronic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1013951896 6:115792766-115792788 ACCTTTTGATGAGGGAGGGGTGG + Intergenic
1014143000 6:117965543-117965565 TCCTTTTGGGGAGGGAGGACGGG - Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1016551418 6:145284221-145284243 TCAGTTTGTCCAGGGAGTGCTGG + Intergenic
1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG + Intronic
1017471367 6:154740045-154740067 TCATTTTCTAGAGGGAGTTCTGG + Intronic
1021106129 7:16641781-16641803 TCCTTTTTTTGAGGGGGGGCTGG - Intronic
1021372048 7:19861284-19861306 TCCATTTGATGATGGAGTTCTGG + Intergenic
1021687520 7:23201753-23201775 TTTTTTTGTTGGGGGAGGGCAGG - Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023287723 7:38636715-38636737 TCCTTGTGTTCAAGGAGGGCGGG - Intergenic
1023452809 7:40305409-40305431 TCCTGTTGTGGAGAGAGAGCAGG + Intronic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1027555884 7:79664480-79664502 TGCTTTTGTTGAGGGGGTTGGGG - Intergenic
1027736819 7:81942827-81942849 TCCTTTCCTTGAGGGACTACTGG - Intergenic
1030072499 7:105710043-105710065 TTCTTTTGTAGAGGCAGGGCTGG + Intronic
1031010560 7:116522426-116522448 TCCTTTTCTTGCTGGAATGCAGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034267073 7:149786232-149786254 TCCAATGGTTGAGGGAGGGCAGG - Intergenic
1036225917 8:6957501-6957523 TCCTCTTGTTGAGACAGTGACGG - Intergenic
1037384234 8:18320346-18320368 TGTTTTTGGTGAAGGAGTGCAGG + Intergenic
1037456583 8:19070268-19070290 TTTTTTTGCTGATGGAGTGCAGG - Intronic
1039193729 8:35006468-35006490 TCTTTTTGTTGAGACAGTGCTGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044262629 8:90145144-90145166 TTCTTTTGGTGTGGGATTGCTGG + Intergenic
1044340146 8:91037447-91037469 TAATTTTGTTGAGGGAGTCGGGG - Intronic
1045092492 8:98760711-98760733 TCTTTTTTTTGAGGGGGTGGGGG + Intronic
1046611143 8:116426827-116426849 TCCTTGTTCTGATGGAGTGCAGG - Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048617698 8:136095873-136095895 TATTTTTGTTGAGGAAGTGTGGG + Intergenic
1049524110 8:143112258-143112280 TCCATTTGTGGAGGGAACGCAGG + Intergenic
1049544608 8:143224192-143224214 TCCATTTGTGGAGGGAACGCAGG - Intergenic
1049656677 8:143802170-143802192 TCCTGTCCTTGAGGGAGTCCTGG - Intronic
1049704434 8:144034177-144034199 GCATGTTGTAGAGGGAGTGCTGG + Intronic
1050324265 9:4485002-4485024 TCCTTTTTTTGGGGGGGTGGGGG + Intergenic
1051124201 9:13785812-13785834 TCCTTTAGTTGAGGAAGGGGTGG - Intergenic
1052302278 9:26966184-26966206 TCCTTTTGCAGTGGGATTGCTGG + Intronic
1053186349 9:36019858-36019880 TCAATTTGTGGAGGGAATGCAGG + Intergenic
1053358476 9:37466282-37466304 TTTTTTTGTGGGGGGAGTGCAGG - Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055438871 9:76319640-76319662 TCCTTTTCTTGAGGGAGTCAGGG + Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057083857 9:92191094-92191116 TCCTTTTGTTGCTGGAGTGGTGG - Intergenic
1057126223 9:92618192-92618214 TCCTTTTGTTGAGAAAGGCCTGG + Exonic
1057414048 9:94845728-94845750 GCCATTTGTTGAGGGAGGGCTGG + Intronic
1057443847 9:95099961-95099983 TCCTGTTGTGGAGGGACTCCTGG - Exonic
1059523275 9:114963909-114963931 TCTTTTTATGGAGCGAGTGCTGG - Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1062093153 9:134689106-134689128 TCCTCTTGCTGAGGGCCTGCTGG + Intronic
1185820763 X:3201593-3201615 TCCTTTTGTTGAAGAAGCACAGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186160461 X:6771944-6771966 TCTTTTTGTTGAGGGTTTGGAGG - Intergenic
1186235828 X:7508340-7508362 TCTTTTTGTTTATGGTGTGCTGG + Intergenic
1186502633 X:10064460-10064482 TCCTTTGGTTGGTGAAGTGCGGG + Intronic
1189315815 X:40055811-40055833 TCCTTTTTTTGCGGGGGTGGGGG + Intronic
1189662238 X:43312598-43312620 TTCTTTTGTTGAGGGACAACAGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1192824502 X:74681346-74681368 TCCATTTGGTGATTGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1197743521 X:129914581-129914603 TCTTTTTTTTGGGGGAGGGCGGG - Intronic
1198848986 X:140944963-140944985 TCCTTTTTTTGAGGAACTACTGG - Intergenic
1199240317 X:145540824-145540846 TCCATTTGATGATGCAGTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic