ID: 914928622

View in Genome Browser
Species Human (GRCh38)
Location 1:151909794-151909816
Sequence CAGTCGGCGCGCGGGTTCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914928622_914928631 12 Left 914928622 1:151909794-151909816 CCCCGGAACCCGCGCGCCGACTG 0: 1
1: 0
2: 0
3: 5
4: 44
Right 914928631 1:151909829-151909851 TCATCCTTCCCACATGACCCAGG 0: 1
1: 0
2: 0
3: 24
4: 198
914928622_914928632 13 Left 914928622 1:151909794-151909816 CCCCGGAACCCGCGCGCCGACTG 0: 1
1: 0
2: 0
3: 5
4: 44
Right 914928632 1:151909830-151909852 CATCCTTCCCACATGACCCAGGG 0: 1
1: 0
2: 3
3: 22
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914928622 Original CRISPR CAGTCGGCGCGCGGGTTCCG GGG (reversed) Exonic
902772822 1:18655586-18655608 CAGTCGGCGGGAGGGTTTCCAGG + Intronic
914928622 1:151909794-151909816 CAGTCGGCGCGCGGGTTCCGGGG - Exonic
923684162 1:236142444-236142466 CGGTCGGCGCGCGGGGGCGGCGG + Intergenic
1066402629 10:35090403-35090425 GTGTCGGCGCGCGGGCTCCCCGG - Intronic
1070328863 10:75404287-75404309 GAGTCGGCGAGCGGGTGGCGAGG + Intergenic
1076793648 10:132788808-132788830 CAGACGCCGCGGGGGTGCCGGGG - Intergenic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1089533807 11:119149053-119149075 CAGTCGCCCCGCGGGCTCGGAGG + Exonic
1097057498 12:56258521-56258543 GAGCCGGCGCGCGAGTTCGGGGG - Intergenic
1108662597 13:52600285-52600307 TGGGCGGCGCGCGGGTCCCGCGG + Intergenic
1113914721 13:113863547-113863569 CAGCCGGCGGGCGGGATGCGGGG - Intronic
1113914884 13:113864130-113864152 CGGGCGGGGCGCGGGTTCCCGGG + Intergenic
1121595367 14:95157759-95157781 GCCTCGGCGCGCGGGTTCCCGGG - Intronic
1125543516 15:40486561-40486583 CCCTCCGCGCGCGGATTCCGTGG + Intergenic
1125544091 15:40489754-40489776 CCCCCGGCGCTCGGGTTCCGTGG + Intergenic
1127480330 15:59372040-59372062 GAGTCGGCGCGAGGGTGCCCGGG + Intronic
1130270646 15:82445268-82445290 CAGGGGGCGCGCGGGTTGAGGGG + Intergenic
1130462990 15:84172591-84172613 CAGGGGGCGCGCGGGTTGAGGGG + Intronic
1130489684 15:84422197-84422219 CAGGGGGCGCGCGGGTTGAGGGG - Intergenic
1130501275 15:84500959-84500981 CAGGGGGCGCGCGGGTTGAGGGG - Intergenic
1132464778 16:72460-72482 CCGGGGGCGGGCGGGTTCCGGGG - Intronic
1132778944 16:1612557-1612579 CAGCCGGCGCTCGGGGGCCGGGG + Intronic
1139469426 16:67170404-67170426 CAGCCAGCGCGCGGCCTCCGCGG + Intronic
1143495209 17:7308402-7308424 TAGTCCTCGCGGGGGTTCCGAGG + Intronic
1143527004 17:7478947-7478969 CCGACGGCGCGGCGGTTCCGGGG + Intronic
1148656208 17:49285717-49285739 CAGTCGTCGTGTGGGTTCCTGGG - Intergenic
1150431669 17:65123201-65123223 CCCGCGGCGCGCGAGTTCCGTGG + Intergenic
1151572826 17:74935807-74935829 CAGCCGCCGCTCGGGCTCCGCGG - Exonic
1153935327 18:9914916-9914938 CAGCCGGCCCTCGGGTTCCGCGG + Intronic
1163113812 19:15177753-15177775 CAGGCGGCGCGCGGGCACCGCGG + Exonic
1168154052 19:54463461-54463483 CGGCGGGGGCGCGGGTTCCGTGG + Exonic
948750549 2:240129945-240129967 CAGTCGGAGCACGGGGTCCGTGG - Exonic
1168804475 20:664302-664324 CTGTCGGCGCGCTACTTCCGAGG - Exonic
1185259273 22:49852939-49852961 CAGTCGGCGTGCGGGTGAAGGGG + Intergenic
969254761 4:5994330-5994352 CAGCAGGTGCGCGGGTACCGCGG - Intergenic
999252319 5:150190215-150190237 CAGCCGGTGCGCGGGAGCCGCGG + Exonic
1002185858 5:177454600-177454622 CCCTCGGCGCCCGGGCTCCGCGG + Intronic
1005589952 6:27312651-27312673 CTGTCGGCCCGCGGGATCCCCGG + Intergenic
1008895028 6:56542916-56542938 GAGTCGGCGAGCGGTTTCAGTGG + Intronic
1011195323 6:84774337-84774359 GAGTCGGGGCGCGGGCGCCGCGG - Intergenic
1021411305 7:20331712-20331734 CACTCGGCCCGCGGGCCCCGAGG + Exonic
1029494452 7:100889609-100889631 CAGTCTGCGCGCCGGTCCTGCGG - Exonic
1031051873 7:116953414-116953436 CCGGCGGCGGGCGGGCTCCGGGG + Exonic
1037547706 8:19939985-19940007 CAGTCGGCCCGCGAGTCCCCGGG - Intronic
1037860007 8:22398371-22398393 CAGTGGGCGCGAGGGGTCGGGGG + Intronic
1038798206 8:30727762-30727784 CGGGCGGCGCGCGCCTTCCGAGG - Exonic
1040495391 8:47961010-47961032 CCGCCGGCGCGCGGTTACCGTGG - Exonic
1042859009 8:73294888-73294910 GAGCCGGCGCGCCGGTTCCGGGG + Exonic
1049299698 8:141863007-141863029 CAGTGGGCTCGAGGGTTCCAAGG - Intergenic
1200310372 X:155071395-155071417 CCTTCGGCGCGCGGGTTCCTAGG - Intronic