ID: 914928629

View in Genome Browser
Species Human (GRCh38)
Location 1:151909806-151909828
Sequence CGCGCCGACTGGAGGCTTTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914928613_914928629 22 Left 914928613 1:151909761-151909783 CCGGTTATCGCCTTGGGCCCCTC 0: 1
1: 0
2: 0
3: 1
4: 79
Right 914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
914928619_914928629 -3 Left 914928619 1:151909786-151909808 CCCCTCAGCCCCGGAACCCGCGC 0: 1
1: 0
2: 0
3: 45
4: 236
Right 914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
914928620_914928629 -4 Left 914928620 1:151909787-151909809 CCCTCAGCCCCGGAACCCGCGCG 0: 1
1: 0
2: 0
3: 11
4: 140
Right 914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
914928621_914928629 -5 Left 914928621 1:151909788-151909810 CCTCAGCCCCGGAACCCGCGCGC 0: 1
1: 0
2: 1
3: 27
4: 285
Right 914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
914928617_914928629 4 Left 914928617 1:151909779-151909801 CCCTCAGCCCCTCAGCCCCGGAA 0: 1
1: 0
2: 1
3: 49
4: 484
Right 914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
914928616_914928629 5 Left 914928616 1:151909778-151909800 CCCCTCAGCCCCTCAGCCCCGGA 0: 1
1: 0
2: 12
3: 109
4: 534
Right 914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
914928612_914928629 23 Left 914928612 1:151909760-151909782 CCCGGTTATCGCCTTGGGCCCCT 0: 1
1: 0
2: 1
3: 4
4: 69
Right 914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
914928618_914928629 3 Left 914928618 1:151909780-151909802 CCTCAGCCCCTCAGCCCCGGAAC 0: 1
1: 0
2: 7
3: 124
4: 668
Right 914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
914928614_914928629 12 Left 914928614 1:151909771-151909793 CCTTGGGCCCCTCAGCCCCTCAG 0: 1
1: 0
2: 14
3: 89
4: 666
Right 914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914928629 Original CRISPR CGCGCCGACTGGAGGCTTTG CGG Exonic
900647213 1:3714424-3714446 CACCCTGACTGGTGGCTTTGAGG - Intronic
904676294 1:32201110-32201132 CCAGCCGACCGGAGGCTTGGGGG + Intronic
907269287 1:53281188-53281210 CGGGCCGATTGGAGCCGTTGGGG - Intronic
914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG + Exonic
923429125 1:233904564-233904586 CGCTCCGCCTGGAAGCCTTGGGG - Intergenic
1067948113 10:50703888-50703910 GGAGCCTGCTGGAGGCTTTGTGG + Intergenic
1070883425 10:79868886-79868908 GGAGCCTGCTGGAGGCTTTGTGG + Intergenic
1071649991 10:87385193-87385215 GGAGCCTGCTGGAGGCTTTGTGG + Intergenic
1076291875 10:129351760-129351782 TGCTCCCACTGGAGGCTTTGGGG - Intergenic
1077051402 11:568530-568552 CGCGCCCACTGGCTGCGTTGCGG - Intergenic
1091363029 11:134993276-134993298 CACTCCTTCTGGAGGCTTTGGGG - Intergenic
1096532875 12:52253036-52253058 CTCGCTGAATGGAGGCATTGGGG - Intronic
1096607480 12:52777045-52777067 CTCCCGGGCTGGAGGCTTTGGGG - Exonic
1096610176 12:52795799-52795821 CTCCCGGGCTGGAGGCTTTGGGG - Exonic
1104382939 12:128323785-128323807 CGCTCAGGCTGGAGTCTTTGAGG + Intronic
1126183007 15:45804248-45804270 CGTGCCCTCTGGAGGCTTGGAGG + Intergenic
1127577631 15:60307511-60307533 TGAGCCCACTGGAGGTTTTGAGG + Intergenic
1129034476 15:72641141-72641163 CCAGCAGGCTGGAGGCTTTGGGG + Intergenic
1129215406 15:74096075-74096097 CCAGCAGGCTGGAGGCTTTGGGG - Intergenic
1129732552 15:77940404-77940426 CCAGCAGGCTGGAGGCTTTGGGG - Intergenic
1132296455 15:100738319-100738341 CCTGCCGATTGGAGGGTTTGAGG + Intergenic
1132702333 16:1227160-1227182 CACGCCCACTGGAGGTTTTGCGG - Intergenic
1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG + Intergenic
1138565153 16:57827706-57827728 TGTGCCCACTGGAGGGTTTGTGG - Intronic
1142015327 16:87743035-87743057 GGCACCAACTGGAGGCTTTTGGG + Intronic
1154294455 18:13136884-13136906 CGCCCCGAAAGGAGGCTCTGGGG - Intergenic
1162082215 19:8224979-8225001 CGCGCAGACGGGAGGTATTGGGG + Intronic
1164312678 19:24059902-24059924 CCTGCCCACAGGAGGCTTTGTGG + Intronic
928353583 2:30586331-30586353 CGCTCCCTCTGAAGGCTTTGGGG + Intronic
932449583 2:71800853-71800875 CATCCCCACTGGAGGCTTTGGGG - Intergenic
1169935663 20:10880714-10880736 CGGGCCTACGGGAGACTTTGTGG + Intergenic
1175470603 20:59224259-59224281 CTCGCCGCCTGGGTGCTTTGAGG + Intronic
1181029473 22:20142932-20142954 CCCGCCGGCTCGAGGCCTTGAGG - Exonic
1181560039 22:23694663-23694685 GGAGCCAACTGGAGGCTTTCAGG + Intronic
1181627992 22:24134296-24134318 CGGGCCCACTGGAGGTTCTGGGG - Exonic
1183600876 22:38840092-38840114 GGCTCCCACTTGAGGCTTTGGGG + Intronic
1183956102 22:41381667-41381689 GGCGCCTGCTGGAGTCTTTGTGG - Intronic
954376041 3:50194664-50194686 GGCGCCGCCTGGCGGCCTTGCGG - Intronic
957564792 3:81870514-81870536 CGTTCCCACTGGAGGCTTTCAGG + Intergenic
962498430 3:135965776-135965798 CGCGCCGCGGGGAGGCTTGGAGG + Exonic
968456834 4:704607-704629 CGCGCAGTGTGGAGGCTTGGTGG - Intergenic
980053657 4:128061057-128061079 CGCCCCGACTGCAGGCTCAGGGG - Intergenic
981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG + Intronic
992367231 5:76105228-76105250 TGCTCCCTCTGGAGGCTTTGAGG - Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1000552575 5:162685208-162685230 AGCTCCTTCTGGAGGCTTTGAGG - Intergenic
1001652265 5:173324295-173324317 CGCGCAGCCCGGAGGCATTGTGG + Intronic
1006706810 6:36027801-36027823 CGCGACCACTGGAGCCTTAGCGG + Exonic
1019263127 7:93468-93490 CGATCCGACGGGAGGCTGTGCGG - Intergenic
1019422262 7:956229-956251 CCCTCAGACGGGAGGCTTTGGGG + Intronic
1019493247 7:1324742-1324764 CGCACCTCCTGGAGGCTGTGAGG - Intergenic
1020705715 7:11541578-11541600 TGAGCCCACTGGAGGCTCTGGGG - Exonic
1029016519 7:97320408-97320430 GGCACCCAATGGAGGCTTTGAGG - Intergenic
1045582718 8:103499092-103499114 AGCGACCACTGGAGGCTGTGAGG - Intergenic
1056574918 9:87848791-87848813 GGAGCCTGCTGGAGGCTTTGTGG - Intergenic
1059248007 9:112864710-112864732 GCCACCGAATGGAGGCTTTGGGG + Intronic