ID: 914931277

View in Genome Browser
Species Human (GRCh38)
Location 1:151935898-151935920
Sequence GCTCATTTAATATCTAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914931277_914931279 8 Left 914931277 1:151935898-151935920 CCAGTACTAGATATTAAATGAGC No data
Right 914931279 1:151935929-151935951 TCAAGTTCAACAGAGTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914931277 Original CRISPR GCTCATTTAATATCTAGTAC TGG (reversed) Intergenic
No off target data available for this crispr