ID: 914932867

View in Genome Browser
Species Human (GRCh38)
Location 1:151950169-151950191
Sequence CACTGCCCACATCCAGTGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 176}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914932865_914932867 -1 Left 914932865 1:151950147-151950169 CCACTTGGGGACTTGGCCATGTC 0: 1
1: 0
2: 1
3: 15
4: 125
Right 914932867 1:151950169-151950191 CACTGCCCACATCCAGTGTGCGG 0: 1
1: 0
2: 2
3: 23
4: 176
914932863_914932867 3 Left 914932863 1:151950143-151950165 CCTCCCACTTGGGGACTTGGCCA 0: 1
1: 0
2: 0
3: 14
4: 116
Right 914932867 1:151950169-151950191 CACTGCCCACATCCAGTGTGCGG 0: 1
1: 0
2: 2
3: 23
4: 176
914932858_914932867 22 Left 914932858 1:151950124-151950146 CCAGCTGCTTTGGCTATCTCCTC 0: 1
1: 0
2: 0
3: 33
4: 532
Right 914932867 1:151950169-151950191 CACTGCCCACATCCAGTGTGCGG 0: 1
1: 0
2: 2
3: 23
4: 176
914932857_914932867 23 Left 914932857 1:151950123-151950145 CCCAGCTGCTTTGGCTATCTCCT 0: 1
1: 0
2: 1
3: 21
4: 399
Right 914932867 1:151950169-151950191 CACTGCCCACATCCAGTGTGCGG 0: 1
1: 0
2: 2
3: 23
4: 176
914932864_914932867 0 Left 914932864 1:151950146-151950168 CCCACTTGGGGACTTGGCCATGT 0: 1
1: 0
2: 1
3: 11
4: 117
Right 914932867 1:151950169-151950191 CACTGCCCACATCCAGTGTGCGG 0: 1
1: 0
2: 2
3: 23
4: 176
914932856_914932867 28 Left 914932856 1:151950118-151950140 CCTCGCCCAGCTGCTTTGGCTAT 0: 1
1: 0
2: 3
3: 66
4: 2003
Right 914932867 1:151950169-151950191 CACTGCCCACATCCAGTGTGCGG 0: 1
1: 0
2: 2
3: 23
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914932867 Original CRISPR CACTGCCCACATCCAGTGTG CGG Intergenic
900283535 1:1888280-1888302 CACTGCCCAGGCCCAGTGTGAGG - Intronic
900524033 1:3119848-3119870 CACAGCCCATCTGCAGTGTGCGG + Intronic
901137604 1:7007975-7007997 CCCTGTCCTCATCCAGTGGGAGG + Intronic
903804499 1:25995235-25995257 CACTGTCCACATCCATTATCTGG + Intronic
904287214 1:29460436-29460458 CACTGCCCACAGCCTGGGAGAGG - Intergenic
907314267 1:53558582-53558604 CACTGCCCTTCTCCAGTGTCTGG + Intronic
909330671 1:74406227-74406249 CACAGCCCACAGGCTGTGTGTGG + Intronic
910000057 1:82330870-82330892 CTCTGCCCTCCTCCAGTGTAGGG - Intergenic
912500509 1:110119031-110119053 CCCTGCCCACATTCAGAGGGAGG + Intergenic
913259081 1:116982406-116982428 CACAGCCCACAGCATGTGTGAGG - Intronic
914932867 1:151950169-151950191 CACTGCCCACATCCAGTGTGCGG + Intergenic
915542862 1:156579782-156579804 GACCACCCCCATCCAGTGTGGGG - Intronic
916785963 1:168087295-168087317 CACAGCCCAGATCCTGGGTGAGG - Intronic
919068783 1:192727373-192727395 CACTGGCCACATCCAGTCCAAGG + Intergenic
919958124 1:202439015-202439037 CAGTGCCCACTACCAGTGGGCGG + Intronic
921421593 1:214955164-214955186 CTCTGCCCCCATTTAGTGTGTGG - Intergenic
921629812 1:217419792-217419814 CAATGCCTGCACCCAGTGTGAGG + Intergenic
922739679 1:228008050-228008072 CACTGCACATATCCTGTGGGAGG + Intronic
924122493 1:240815927-240815949 CACTTCCCACATCCAATGATAGG - Intronic
1062949301 10:1485531-1485553 CGCTGCCCACTTGCAGTGGGTGG + Intronic
1063251156 10:4276464-4276486 CACTGCACACTTCTAATGTGAGG - Intergenic
1063386279 10:5618171-5618193 CACTGCCCAGATGCAGAGTGTGG - Intergenic
1063611102 10:7562824-7562846 CCCTGCCCACATCCACAGAGGGG - Exonic
1066361166 10:34732863-34732885 CAATACTCACACCCAGTGTGAGG + Intronic
1069789787 10:71012235-71012257 CACAGCCCCCATCGAGAGTGTGG - Intergenic
1070703452 10:78619841-78619863 CACTCCCCACATCCATTCTCAGG + Intergenic
1073047294 10:100647187-100647209 CTCTGACCACATCCAGGGTTTGG - Intergenic
1075122314 10:119673007-119673029 CACTGCCTACACCCAAGGTGAGG - Intronic
1075393038 10:122106881-122106903 CTCTACCCACATTCAGTGTGTGG + Intronic
1075736975 10:124670040-124670062 CACTTCCCAGAGCCAGGGTGAGG + Intronic
1076830065 10:132989600-132989622 CACAGCCCAGATCCCATGTGTGG - Intergenic
1077104829 11:837674-837696 CACTGCCCACAGCCAGTCACTGG - Intronic
1077164076 11:1127303-1127325 CAGTGCCCTCACCCAGCGTGGGG - Intergenic
1077185641 11:1234284-1234306 CACAGCCCACGTCCAGCGTGTGG - Exonic
1077929894 11:6720352-6720374 CACTGCCCAGATCCAGAATGGGG - Intergenic
1082831094 11:57617887-57617909 CACTGCACTCCTCCAGTCTGGGG + Intergenic
1084849230 11:71925451-71925473 CACAGGCCACAGCCAGTATGCGG + Intronic
1088110109 11:106251209-106251231 CACTGTCCTAATCCAGTGAGGGG + Intergenic
1088796059 11:113267754-113267776 CACTGCGCACATCCAGGGGAGGG - Intronic
1089057823 11:115600986-115601008 CACTGCCCAGCACCAGTGTGTGG + Intergenic
1091460856 12:642820-642842 CACTTCCCGCATCCGGTCTGCGG - Intronic
1094153518 12:27312958-27312980 CACTGCGCCCATCCAGTCTCAGG - Intronic
1095658764 12:44703161-44703183 AACTGTCCACATACAGTGAGTGG - Intronic
1096614966 12:52827027-52827049 GAGTGCCCACATCGAGTGTGTGG - Intronic
1097550113 12:61057222-61057244 CTTTGCCCACATCCATTGAGAGG - Intergenic
1102093457 12:110214727-110214749 CAGTGCCCACATCCTGTCTTTGG + Intronic
1103941397 12:124503263-124503285 CACGGCCCACACCCAGTGACAGG + Intronic
1104006841 12:124898855-124898877 CACTGCCCCCTCCCAGCGTGGGG - Intergenic
1105786083 13:23750657-23750679 CACTGCCCACATAATGAGTGGGG + Intronic
1112094063 13:96113057-96113079 CACTGCCCTCATGGTGTGTGTGG + Intronic
1113026071 13:105942821-105942843 CAGTCCCCACCTCCAGTGTTGGG - Intergenic
1113481857 13:110627086-110627108 CAATGGCCACATGCAGTGTGGGG + Intronic
1114606343 14:24000970-24000992 CACTGCCCTCAGCCTGTGTGGGG - Intronic
1114611894 14:24048263-24048285 CACTGCCCTCAGCCTGTGTGGGG - Intergenic
1117589633 14:57254144-57254166 CACTGCGCCCAGCCAGTGTTAGG - Intronic
1118753929 14:68824593-68824615 CACTGCCCACTTCGGGAGTGGGG + Intergenic
1119142358 14:72278898-72278920 CACTGCCCACAGCCAGGAAGTGG - Intronic
1124500607 15:30224289-30224311 CACTGCCCTCATCCAGTCGCTGG + Intergenic
1124742965 15:32314378-32314400 CACTGCCCTCATCCAGTCGCTGG - Intergenic
1129109572 15:73329602-73329624 CACTGCCCTCATCCAGTCCCTGG - Exonic
1132404056 15:101531533-101531555 CTCTGCCCACAGCCAGAATGCGG - Intergenic
1132592717 16:733310-733332 CACAGTCCACATCCCGTGTCTGG + Exonic
1132883329 16:2171829-2171851 CTCGGCCCACACCCACTGTGGGG - Intronic
1133630503 16:7615750-7615772 CACTGCTGACATCTAGTGGGTGG + Intronic
1134079116 16:11312876-11312898 CAGTGCCCAGATCCTGGGTGGGG - Intronic
1137402539 16:48165122-48165144 CACTGCCCTCATCACGGGTGAGG - Intergenic
1137424145 16:48363376-48363398 CAGTGCCCACCTCAAGAGTGAGG + Intronic
1137851858 16:51753948-51753970 CACTTCCTTCCTCCAGTGTGGGG + Intergenic
1139876284 16:70148610-70148632 CCCTTCCCACAACCACTGTGGGG + Intronic
1141177031 16:81727677-81727699 CTCAGGCCACATACAGTGTGGGG + Intergenic
1142955865 17:3521312-3521334 CACTGCCCCCAGCAAGTGTGAGG - Intronic
1145056896 17:19708653-19708675 CACTGCCCTATTCCAGTGGGAGG - Intronic
1145816595 17:27799203-27799225 CACTGGCCACAGGCAGGGTGAGG + Intronic
1146086885 17:29838255-29838277 CAGTGACCAAACCCAGTGTGTGG - Intronic
1146272857 17:31495852-31495874 CACTGCACACACACAGTCTGCGG + Intronic
1146282623 17:31554797-31554819 GACAGCCCACATCCAGTGAGTGG - Intergenic
1151304997 17:73257634-73257656 CACTGCCACCCTCCAGGGTGAGG + Intronic
1151885318 17:76920138-76920160 CACTGCCAACAGCCAGTGCTTGG - Intronic
1157447398 18:47755732-47755754 CACTGCCCACAGCTAGCCTGTGG + Intergenic
1158195660 18:54882507-54882529 CATAGCCCACATGCAGTGTTGGG + Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1159700346 18:71618613-71618635 CAGAGCCCACATTCAATGTGGGG + Intergenic
1160398944 18:78594837-78594859 CACTGCTCACCTCCTGTGTATGG + Intergenic
1160723593 19:608131-608153 CACTGCCCTCATCCAGTCGCTGG + Exonic
1161019738 19:2003183-2003205 CACTGCACCCAGCCTGTGTGCGG - Intronic
1161166283 19:2789553-2789575 CACACCCCACACCCAGTGGGGGG - Intronic
1161388554 19:4009469-4009491 CCCTGCCCTCAGCCAGGGTGGGG - Intronic
1164080372 19:21857120-21857142 CACTGCCCACAGCCACTGGCTGG + Intergenic
1166351208 19:42199271-42199293 CAGAGCCCACATCCTGTGGGAGG + Exonic
925733235 2:6937849-6937871 CATTGCCCACATGCAGCCTGAGG - Intronic
930122064 2:47768440-47768462 CTCTGCTCACTTCCAGGGTGTGG + Intronic
937305060 2:120865961-120865983 CACTGCCCAGACTCAGAGTGGGG + Intronic
938086973 2:128408085-128408107 CTGTCCCCACATCCAGTCTGTGG - Intergenic
938102289 2:128505231-128505253 CACAGCCCACCGCCAGAGTGGGG - Intergenic
938682666 2:133707328-133707350 CACTGTTCACATACACTGTGGGG - Intergenic
938730091 2:134140622-134140644 CTGTGCCCACATCCAGGGTGGGG + Intronic
942802352 2:179890222-179890244 CACAGCCCATATCCAGTGACTGG - Intergenic
947579597 2:231306813-231306835 CACTGCCCAGATCCTCTGTGTGG - Intronic
948552461 2:238783088-238783110 CACTGCCTCCTTCCAGTGTTCGG + Intergenic
948586428 2:239022872-239022894 CACTACCCACAAACAGTGAGTGG - Intergenic
1168813805 20:723095-723117 CACTGACCACAGCCAGAGAGGGG - Intergenic
1168977085 20:1974852-1974874 CACAGCCCACCTCCAGTGACTGG + Intergenic
1169851028 20:10050870-10050892 TGCTGCCCTCCTCCAGTGTGGGG + Intronic
1171480845 20:25454661-25454683 CACGGACCACATTCAGTGTTAGG - Intronic
1171503520 20:25613870-25613892 CACTGCCTACATCCATCCTGTGG + Exonic
1172292336 20:33784902-33784924 CACTGCACCCAGCCTGTGTGAGG + Intronic
1173190661 20:40873231-40873253 CAATGCCCACATGCATTGTAGGG + Intergenic
1176197458 20:63844068-63844090 CACAGCCCACAGCCAGGGAGCGG - Intergenic
1176241012 20:64075841-64075863 CACAGACCCCATACAGTGTGTGG - Intronic
1179020849 21:37639636-37639658 TTCTGCCCACCTCCAATGTGAGG + Intronic
1179481170 21:41679540-41679562 CACTGCCCACTTTCCGTGGGGGG - Intergenic
1179632779 21:42688926-42688948 CACTGGCCACGTCCACTGGGGGG - Intronic
1179775839 21:43661490-43661512 CCTGGCCCACATCCAGTGGGAGG + Intronic
1180136893 21:45867793-45867815 CACTGGCCACCTCCAGTGTGGGG - Intronic
1181791718 22:25272611-25272633 CAAGGTCCACAGCCAGTGTGTGG + Intergenic
1181827355 22:25528414-25528436 CAAGGTCCACAGCCAGTGTGTGG + Intergenic
1182899819 22:33888565-33888587 CACTGCACCCAGCCTGTGTGAGG - Intronic
1183110733 22:35646811-35646833 CACTGCCCCCATCCAATGGCCGG + Intergenic
1183394975 22:37566487-37566509 CACGGCCCACATGCATGGTGTGG - Exonic
1183459318 22:37940485-37940507 CCCTCCCCACCTCCAGTGTTTGG - Intronic
1183675625 22:39297446-39297468 GACTCCCCACAGCCAGTCTGGGG - Intergenic
1185109504 22:48893234-48893256 CAGTGCCCTCGTCCTGTGTGTGG - Intergenic
1185257630 22:49844754-49844776 CACTCTCCACCTCCAGTTTGAGG + Intergenic
1185342535 22:50298092-50298114 CAGTGACCAGATCCAGTGTTTGG - Intronic
950336105 3:12194747-12194769 CACAGCTCACCTCCAGGGTGCGG - Intergenic
951738738 3:25896731-25896753 CACTGCCAAGATCCAGGGTAGGG + Intergenic
952876601 3:37950048-37950070 CACTGCCCACACAATGTGTGTGG + Intronic
954752433 3:52821231-52821253 CAGTCCCCACAGTCAGTGTGTGG - Intronic
954755952 3:52840091-52840113 CACTGCCCACAGCCACGGTGAGG + Exonic
954938209 3:54346261-54346283 CACTGCTCTCATCCAGTGTCTGG + Intronic
955109480 3:55933780-55933802 CTTTGCCCACCTCCAGTGCGTGG + Intronic
961447285 3:126986802-126986824 TGGTGCCCACATGCAGTGTGGGG - Intergenic
961551373 3:127672315-127672337 CGCTGGCCACGTCCAGCGTGGGG - Exonic
966686068 3:182697381-182697403 CATCTCCCACATCCTGTGTGTGG + Intergenic
966917768 3:184594345-184594367 TCCTACCCACCTCCAGTGTGGGG + Intronic
968546436 4:1201190-1201212 CACTGCCCACATACTGCGGGGGG - Intronic
968736121 4:2297373-2297395 CTCTGCCCTCTGCCAGTGTGAGG - Intronic
970447704 4:16137788-16137810 CACTGCCCCCACCCTGTGTTAGG + Intergenic
971011674 4:22444630-22444652 GGATGCCCACATCCTGTGTGTGG - Intronic
973953967 4:56044968-56044990 CACTGCGCCCTGCCAGTGTGGGG - Intergenic
974699179 4:65417043-65417065 CACTGTTCACATGCAGTGAGGGG + Intronic
976407724 4:84678807-84678829 CACGGGGCACATCCAGGGTGGGG + Intronic
980768625 4:137341791-137341813 CTCTGCCCCCATCAAATGTGTGG - Intergenic
982727239 4:158918714-158918736 TACTGGCCACATCAACTGTGGGG + Intronic
982858219 4:160412713-160412735 CACTGCCCCCACGCAGTCTGTGG + Intergenic
985334860 4:188881378-188881400 CACTGGCCAATTCCACTGTGAGG - Intergenic
985573835 5:664642-664664 CACCTCCCACGTCCGGTGTGGGG + Exonic
986611405 5:9571470-9571492 CACATCCCACATCCAGAGTGGGG - Intergenic
988603256 5:32658477-32658499 CACTTCCCACATGTTGTGTGAGG - Intergenic
990605759 5:57408237-57408259 AGCTGCCCACATCCACTCTGGGG + Intergenic
991505414 5:67318972-67318994 CACTGGCCCCAGCCAGTGAGGGG + Intergenic
997978527 5:138454428-138454450 CTGTGCCCAGAGCCAGTGTGGGG + Intergenic
1001541524 5:172543011-172543033 CTCTCCCCACATGCCGTGTGGGG + Intergenic
1001712885 5:173792235-173792257 CTCTCCCCACATTCAGTGTAAGG - Intergenic
1002193626 5:177491171-177491193 CACCGCCCACCCCCAGTGTGGGG - Intronic
1003712964 6:8613999-8614021 CACTGCTCACGCCCACTGTGTGG - Intergenic
1004035625 6:11920268-11920290 CACTCTACACAGCCAGTGTGGGG + Intergenic
1008771811 6:54988151-54988173 CACTACCCACAGCCACTGAGAGG - Intergenic
1009956851 6:70465665-70465687 GACTGGCCACACACAGTGTGTGG - Intronic
1011472185 6:87718838-87718860 CCCTGCCCACTTCCAGTGTGAGG - Intergenic
1011626404 6:89286984-89287006 CACTAACCTCACCCAGTGTGGGG + Intronic
1013279583 6:108623038-108623060 CTGTGTCCACCTCCAGTGTGTGG + Intronic
1017552304 6:155522316-155522338 CACTGCCACCATCTACTGTGAGG + Intergenic
1017556514 6:155576994-155577016 CAGTGCCTACATCCTCTGTGGGG - Intergenic
1019034243 6:169041342-169041364 CCCTGCAGACATCCAGTGTCAGG - Intergenic
1022960503 7:35421819-35421841 AACTGCCCACTTCAAGTTTGGGG - Intergenic
1029986833 7:104930402-104930424 CACTGCACTCAGCCAGTGTGGGG - Intergenic
1030845973 7:114411812-114411834 AACTGATCATATCCAGTGTGGGG + Intronic
1032796662 7:135282787-135282809 CACAGCACACATGCAGTTTGTGG - Intergenic
1033451348 7:141464859-141464881 CACTGCTTACAGCCAGTGTGTGG + Intronic
1034451663 7:151140139-151140161 CACTGCCCACCTCCTGTGCCCGG - Intronic
1034763978 7:153700313-153700335 CACGGCCCACATCATGGGTGAGG - Intergenic
1035468530 7:159095329-159095351 TGCTGCACACACCCAGTGTGAGG + Intronic
1037893437 8:22636315-22636337 CAGCACCCACATCCAGAGTGGGG + Intronic
1039323131 8:36454685-36454707 CACTGACCACACCCAGACTGTGG + Intergenic
1039562268 8:38522193-38522215 AACTCCCCATATCCTGTGTGGGG + Intronic
1039790708 8:40873477-40873499 CACTCCCCAAAGCCAGGGTGAGG - Intronic
1040826231 8:51623548-51623570 CTCTGCCCTCCTCCATTGTGGGG + Intronic
1044445382 8:92269424-92269446 CACAGCCCACAGGCAGTATGTGG + Intergenic
1044782857 8:95761455-95761477 TGCAGCCCACATCCAGTGTCCGG - Intergenic
1045036012 8:98177011-98177033 AACTGCCCACTTCCAGAGTAAGG + Intergenic
1047147835 8:122225182-122225204 CACTCACAACATCCATTGTGAGG + Intergenic
1047529404 8:125661472-125661494 CATTCACCACATCCAGTCTGAGG - Intergenic
1047571410 8:126102596-126102618 CACAGCCCACATCCAATGATAGG + Intergenic
1049828964 8:144687555-144687577 AACTGCTCACCGCCAGTGTGTGG - Intergenic
1050290099 9:4145172-4145194 CACTGACCTCATCCATAGTGTGG - Intronic
1050764135 9:9111435-9111457 GACTGACCACATCCAAAGTGAGG - Intronic
1051678053 9:19578697-19578719 CACTGCCCACCTCCATGGTTTGG + Intronic
1053211494 9:36232574-36232596 CAGTGGCAACAGCCAGTGTGAGG - Intronic
1056649422 9:88445103-88445125 CACTGAGTACATCCAGTGTGGGG + Intronic
1057080724 9:92172645-92172667 CACTGCCCGCATCCAGCCTCAGG - Intergenic
1057489211 9:95508643-95508665 CGCTGCCCACATCCAGTTCGCGG + Exonic
1057905249 9:98977818-98977840 CCCTGCCCACTTCCCATGTGGGG - Intronic
1060049979 9:120371672-120371694 CACTGCCCTCTTCCCTTGTGGGG - Intergenic
1061514460 9:131080717-131080739 CACTGCCCTCGTCCAGGGTGAGG + Intronic
1061838695 9:133345358-133345380 CACTGGCCACAACCTGTCTGTGG + Intronic
1187423490 X:19156997-19157019 CACTGCGCCCAGCCAATGTGTGG - Intergenic
1191942788 X:66498853-66498875 CACTGCCCTCACCCTGGGTGGGG - Intergenic
1193612357 X:83647864-83647886 CACTCCCCACCTCCAGTATTGGG + Intergenic
1195614508 X:106901894-106901916 CAGGCCCCACAGCCAGTGTGTGG - Intronic
1197276311 X:124483494-124483516 CATTTCCCACATCCAGTGAAAGG + Intronic
1199548687 X:149034661-149034683 CACTGCCCCCGACCAGTGAGAGG + Intergenic