ID: 914936376

View in Genome Browser
Species Human (GRCh38)
Location 1:151984414-151984436
Sequence CACCCTCAGCTTCCTGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 455}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914936376 Original CRISPR CACCCTCAGCTTCCTGGCTG TGG Intronic
902101777 1:13996433-13996455 CACACTAAGCTCCCTGGGTGGGG + Intergenic
902538443 1:17135434-17135456 CACCTTAGGCTTTCTGGCTGGGG + Intergenic
902808742 1:18876398-18876420 CAGCCTCACCATCCTGGCCGGGG - Exonic
903372039 1:22842618-22842640 CACCCTCAGCCTCCTTTCTGTGG + Intronic
903852739 1:26318044-26318066 CACCATCAGCCTCCTGGTTATGG + Exonic
903893228 1:26584270-26584292 CACACTCATCTCCCTGGCAGAGG - Intergenic
904145561 1:28388107-28388129 CATCCTCAGTCTCCTGGCTCAGG - Intronic
905389216 1:37625535-37625557 CTTCCTCAGTCTCCTGGCTGAGG - Intronic
906657068 1:47556056-47556078 CCCCGTCGGCTTCCTGGCGGAGG - Intergenic
908523323 1:64965861-64965883 GACCCTCAGCCTCCTTCCTGGGG + Intronic
909697504 1:78484095-78484117 CACGCTAAGCTCCCTGGGTGGGG + Intronic
910518361 1:88088617-88088639 CACCCTAATCTCCCTGGGTGGGG - Intergenic
910595712 1:88978417-88978439 CAGCCTCAACCTCCTGGCTAAGG + Intronic
911270579 1:95797088-95797110 CCCCTTGAGCTTCCTGGGTGAGG - Intergenic
911541429 1:99162500-99162522 CCCCTTGAGCTTCCTGGGTGAGG + Intergenic
911757730 1:101579387-101579409 CAGCCTCATCCTCCTGGCTTAGG - Intergenic
912953958 1:114139736-114139758 CACCCTGGGCTTCCTGGAGGCGG - Exonic
913339841 1:117747613-117747635 GACCTTCAGGTTCCTGACTGAGG + Intergenic
914936376 1:151984414-151984436 CACCCTCAGCTTCCTGGCTGTGG + Intronic
917079039 1:171237587-171237609 CACACTGAGCTCCCTGGCAGAGG + Intergenic
917163225 1:172080891-172080913 CCCCATAAGCTTCCTGGGTGAGG + Intronic
917947724 1:179993533-179993555 TCACCTCAGCTTCCTAGCTGAGG + Intronic
918697349 1:187560567-187560589 CACACTAAGCTCCCTGGGTGAGG - Intergenic
919020408 1:192098133-192098155 CAGCCTCAGGTTCCGGGGTGTGG - Intergenic
919649815 1:200136297-200136319 CAACCTCCGCTTCCTGGGTTCGG + Intronic
920106347 1:203556145-203556167 CCCCCGCAACTTTCTGGCTGGGG + Intergenic
922573359 1:226646534-226646556 CACCCCCAGGTTCCTGACAGGGG - Intronic
924508173 1:244705480-244705502 CACCCTCCACTCCCTGGCAGTGG + Intronic
924640998 1:245833775-245833797 CAACCTCAGCGTCCTGGCCAGGG + Intronic
1062838369 10:650893-650915 CACCCTCAGCTTCCCCCGTGAGG - Exonic
1063127533 10:3148940-3148962 CACCTTCTGCACCCTGGCTGAGG - Intronic
1063453668 10:6168318-6168340 CATCCTCAGCCTCCAGCCTGAGG - Intronic
1065021510 10:21505854-21505876 GATCCTGAGCTTCCTTGCTGGGG - Intergenic
1065722844 10:28643120-28643142 CTCCCTTTACTTCCTGGCTGTGG + Intergenic
1067710820 10:48649710-48649732 CACCCTCAGCTCCATCACTGTGG - Intronic
1068121580 10:52786373-52786395 CAGGCTCAGCCTTCTGGCTGTGG + Intergenic
1068357184 10:55923776-55923798 CCCCTTCAGCTTCCTGGTTAAGG + Intergenic
1068544905 10:58334820-58334842 CACCTTAAGCTGCCTGGCTGAGG + Intergenic
1069897215 10:71687273-71687295 CACCCCCAGCTCCCATGCTGGGG - Intronic
1070605287 10:77894028-77894050 CACCCACAGCTTCCTATGTGAGG - Intronic
1071134599 10:82438452-82438474 CACACTAAGCTCCCTGGGTGGGG - Intronic
1072228927 10:93396710-93396732 CACCCTTAGCTCCCTGACAGTGG - Intronic
1072252461 10:93592420-93592442 CACCCTCAGCTTTCAGGAAGTGG + Intronic
1072732117 10:97853247-97853269 AGCACTCTGCTTCCTGGCTGGGG - Intronic
1072916416 10:99539854-99539876 CACCCTGAGCTTATTGGGTGGGG - Intergenic
1073370078 10:102980350-102980372 CAGCCTCAACTTCCTGGCTTAGG + Intronic
1073543475 10:104330517-104330539 GACCCTCAGCTGCCTTGCCGTGG + Intronic
1074529243 10:114285933-114285955 CAGGCTCAGCTTCAGGGCTGCGG - Exonic
1076899035 10:133328095-133328117 CAGCGTCAGCTTCGTGGCAGTGG + Intronic
1077215920 11:1395065-1395087 CACCTTCACCTTCATGGCTGGGG - Intronic
1077266034 11:1650750-1650772 CACCCAGAGGTTCCTGCCTGGGG + Intergenic
1077484633 11:2833103-2833125 CACCCACAGCCTCCTAGCTGTGG - Intronic
1077562205 11:3271106-3271128 CTCCCTCTCCTTCCTGCCTGTGG + Intergenic
1077568099 11:3316926-3316948 CTCCCTCTCCTTCCTGCCTGTGG + Intergenic
1078420365 11:11206706-11206728 CACCCTCTGCTTCCTGCCAAAGG - Intergenic
1078477676 11:11645631-11645653 CATCCTCAGCTTTTTGCCTGAGG - Intergenic
1078663971 11:13309343-13309365 CAGGCCCAGCATCCTGGCTGTGG + Intronic
1079529051 11:21427032-21427054 CACCACCAGCTGCCTGGCTGTGG - Intronic
1080690407 11:34552588-34552610 CACCCTGACATTGCTGGCTGGGG + Intergenic
1080901288 11:36494290-36494312 CAGCCTCAAATTCCTGGCTCAGG - Intronic
1081507417 11:43732851-43732873 CAACCTCAGCCTCCTGGCTCAGG + Intronic
1082033025 11:47620398-47620420 CAACCTCTGCCTCCTGGCTGAGG - Intronic
1082968191 11:58989881-58989903 CCCCTTCTGCTTCCTGGGTGAGG + Intronic
1083344322 11:61978943-61978965 CAGCCTCAGCTCTCTGGCGGGGG + Intergenic
1083491323 11:63016824-63016846 TGCCCTGTGCTTCCTGGCTGGGG - Intergenic
1083511952 11:63217620-63217642 CTCCCTGCGCTTCTTGGCTGGGG - Exonic
1084003634 11:66312288-66312310 CACCCAGAGCGCCCTGGCTGCGG - Intergenic
1084409306 11:68997199-68997221 CACCCCCAACTGCCTGCCTGGGG + Intergenic
1084975138 11:72792937-72792959 CCTCCTCAGCTTCTTGGCTCTGG + Exonic
1085641165 11:78193798-78193820 CACCCGAAGCTTCCTGAATGAGG - Intronic
1087177416 11:95108357-95108379 CTCACACACCTTCCTGGCTGTGG - Intronic
1087427704 11:98012258-98012280 CCCCTTGAGCTTCCTGGGTGAGG - Intergenic
1087596053 11:100256676-100256698 CCCCCTATGCTTCCTGGGTGAGG - Intronic
1088712376 11:112520018-112520040 GACTCTCAGCTGCATGGCTGGGG - Intergenic
1088803344 11:113327897-113327919 CACTCGCAGCTTCCTTGCTATGG + Intronic
1089064130 11:115649593-115649615 CAACTTCAGCTGCCTGCCTGGGG + Intergenic
1089092434 11:115889035-115889057 CAACCTCAGCCTCCTGTCTGTGG - Intergenic
1090212858 11:124935157-124935179 CAGCACCAGCTTCCTGGATGGGG + Intronic
1091113567 11:132993820-132993842 CAGCCTCAGATTCCGGGGTGGGG - Intronic
1091137490 11:133205104-133205126 CACCCTCTTCTTCCTGGGAGGGG + Intronic
1091225520 11:133954805-133954827 CACCCTCTGCTTCCAGACAGGGG + Intronic
1091334107 11:134753866-134753888 CCCACTCAGCCTCCTGTCTGGGG + Intergenic
1091712082 12:2749312-2749334 CCCCTTGAGCTTCCTGGATGAGG - Intergenic
1093999291 12:25677092-25677114 CATCCTCTGCTTTCTGTCTGTGG - Intergenic
1094059492 12:26298406-26298428 GACCTCCAGCTTCCTGGCTTGGG - Intronic
1094493400 12:30975333-30975355 CACCCGCAGCCTCCCTGCTGTGG + Intronic
1095258385 12:40068582-40068604 CACCATCATATTCCTGGCTTAGG + Intronic
1096498532 12:52052088-52052110 CACCCTGAACTTTCTGTCTGAGG + Intronic
1096551437 12:52375989-52376011 CATCCTCAGGGTGCTGGCTGGGG + Intergenic
1096725327 12:53556755-53556777 CACCCACAGCCCCCTGGCTTAGG - Intronic
1096973526 12:55685370-55685392 CACCCTCACCATCCCTGCTGCGG + Intronic
1099779100 12:87171579-87171601 CCCCCTGTGCTTCCTGGGTGAGG - Intergenic
1100432812 12:94545864-94545886 CACCCTCTGCTTACAGCCTGTGG - Intergenic
1100635485 12:96431263-96431285 CACCCCCACCTTTCTGACTGTGG - Intergenic
1101432357 12:104637221-104637243 CAGCCTCAACTTCCAGGCTCAGG - Intronic
1101775443 12:107789145-107789167 CTCCCTCAGATGCCTGGCTAAGG + Intergenic
1102220143 12:111188679-111188701 CACACTCAGCTTGCTGGCCCTGG + Intronic
1102258830 12:111431063-111431085 CCACCTCAGCTTCCTTTCTGGGG + Intronic
1103485472 12:121279844-121279866 GCCACTCAGCTTCCTGGCAGAGG - Intronic
1103513286 12:121489978-121490000 CAGCATCAGCTTCATGACTGCGG + Intronic
1104444420 12:128822405-128822427 TTCCCTCAGCTTCCTGGCCCAGG + Intronic
1105015650 12:132785390-132785412 CAGCCTCACCTCCCAGGCTGAGG + Intronic
1105212421 13:18264964-18264986 AAGCCTCTGCTTCCTGTCTGAGG - Intergenic
1105251084 13:18698584-18698606 CACTCTCAGCTCCCAGGCGGGGG + Intergenic
1106109250 13:26761972-26761994 CATCCTCAGCTCCCTGGTTGAGG + Intergenic
1108144643 13:47463825-47463847 TACGCTAAGCTTCCTGGGTGGGG + Intergenic
1108228791 13:48317447-48317469 CCCTTTCAGCTTCCTGGCTAGGG + Intronic
1108616104 13:52133889-52133911 CTCCGTAAGCTTGCTGGCTGAGG + Intronic
1109623705 13:64945335-64945357 CAGCTTCAACTTCCTGGCTCTGG + Intergenic
1109816190 13:67588518-67588540 CCCCTTCTGCTTCCTGGGTGAGG - Intergenic
1112498518 13:99924512-99924534 CAGCCTCAACTTCCAGGCTCAGG + Intergenic
1112783507 13:102927473-102927495 CACCCCCAGCATCCTGCTTGGGG + Intergenic
1114662413 14:24355772-24355794 CGGCCTCAGCCTCCTGGCTTAGG + Intergenic
1114704013 14:24707345-24707367 CACCCTCAGTCTCATGGCAGGGG + Intergenic
1114890086 14:26909477-26909499 CAGCCTCAACTTCCTGGCTCAGG + Intergenic
1115376400 14:32681758-32681780 CAGCCACAGCTTCTTGGCTCAGG + Intronic
1115635354 14:35285703-35285725 CACCCTCAGCTCCCTGAAGGTGG - Intronic
1116040736 14:39683709-39683731 CTCCCTGAGTTTCCTTGCTGTGG + Intergenic
1116111557 14:40591770-40591792 CTCTCTCAGCTTCCAGTCTGTGG + Intergenic
1116212745 14:41968749-41968771 CCCCTTGAGCTTCCTGGGTGAGG + Intergenic
1116734417 14:48671035-48671057 CAGCCTCTGCTTCCTGGAGGTGG - Intergenic
1116873319 14:50088337-50088359 TTCCCACAGCTTACTGGCTGGGG + Intronic
1117166790 14:53042684-53042706 TACCATCAGATTCCTGGCAGAGG + Intronic
1117373669 14:55101591-55101613 CAACCTCTGCTTCCTGGGTTCGG - Intergenic
1117599921 14:57364782-57364804 CCCCTTGAGCTTCCTGGGTGAGG - Intergenic
1117617164 14:57545327-57545349 CCCCTTGAGCTTCCTGGGTGAGG + Intergenic
1117866193 14:60151932-60151954 CTCCCTCATCTGCCTGCCTGAGG + Intronic
1118718015 14:68574056-68574078 CACCCTCAGCTTGCTGGAGTAGG - Intronic
1118775111 14:68969006-68969028 CACCCAAAGGTGCCTGGCTGGGG - Intronic
1118882471 14:69841245-69841267 CACCCTCCACTTCCTACCTGGGG + Intergenic
1119618001 14:76111558-76111580 CACACCCAGCTGCGTGGCTGGGG + Intergenic
1121075049 14:91060691-91060713 CTCCCTTACCTTGCTGGCTGTGG - Intronic
1122262607 14:100531788-100531810 CACCATCAGCCTGCTGGGTGGGG - Intergenic
1122414422 14:101542037-101542059 CCCGCTCAGCCTCCAGGCTGAGG + Intergenic
1122742719 14:103881338-103881360 CAGCCTCAGCTTCCTGGGGCAGG - Intergenic
1122878390 14:104679135-104679157 CACCCTCCGTTTGCTGGCAGTGG + Intergenic
1122961313 14:105094718-105094740 CAGCCTCATCTTCCATGCTGAGG - Intergenic
1122986483 14:105214013-105214035 CATCCTCAGGCCCCTGGCTGGGG - Intronic
1124171838 15:27381235-27381257 CACCATCATCTAACTGGCTGGGG - Intronic
1125601442 15:40917920-40917942 CACTCCCAGCTGCCTAGCTGTGG + Intergenic
1125831823 15:42722254-42722276 GACCCTAAGCTTCCTGGGTGGGG + Intergenic
1126441411 15:48693595-48693617 CATCCTCATCTTTCTGACTGTGG + Intergenic
1126708527 15:51430277-51430299 GTGCCTCAGCCTCCTGGCTGGGG + Intergenic
1126958951 15:53968587-53968609 TTTCCTCAGCTTCCTGGCTGAGG - Intergenic
1127001886 15:54518459-54518481 CTCCCTCTCCTTCCTTGCTGGGG - Intronic
1127823771 15:62684562-62684584 CACCCCCAGCTTCCTCACGGAGG - Intronic
1129191331 15:73939314-73939336 CACCCTCAGGATCCTTGCCGAGG - Intronic
1129933409 15:79430993-79431015 CTCCCTCAGCTGTCTGGATGTGG - Intergenic
1131000920 15:88939284-88939306 CACCCCCAGCTTCCAGGCCCAGG + Intergenic
1131651431 15:94403818-94403840 CACCTTGATCTTCCTTGCTGTGG - Intronic
1131791664 15:95972202-95972224 AAACCTCAGCTTCCTGGCTGTGG - Intergenic
1132066235 15:98733293-98733315 CAGCCTCAGCCTCCTGCCTCTGG + Intronic
1132350461 15:101136650-101136672 CACCCTCCGCTTCCAGGACGAGG + Intergenic
1132797945 16:1734446-1734468 CACCCTCTCCTTCCTGGCCAGGG - Intronic
1135164437 16:20126279-20126301 CACCCTCCTCTTCCTGTTTGGGG + Intergenic
1136779442 16:32887158-32887180 CAGACTGAGCTTCCTGGGTGAGG + Intergenic
1136891174 16:33974360-33974382 CAGACTGAGCTTCCTGGGTGAGG - Intergenic
1137056026 16:35747059-35747081 CCTGCTTAGCTTCCTGGCTGAGG - Intergenic
1137057106 16:35751090-35751112 CCGGCTTAGCTTCCTGGCTGGGG - Intergenic
1137463125 16:48683926-48683948 CAGCCTCAGCCTCCTGGCTCAGG + Intergenic
1138651075 16:58462234-58462256 GTCCTACAGCTTCCTGGCTGTGG - Intergenic
1138692924 16:58785792-58785814 CCCCTTGCGCTTCCTGGCTGAGG + Intergenic
1139846475 16:69924916-69924938 CGCCCAGAGCTTCCTGGCTGGGG - Intronic
1139924950 16:70480932-70480954 CTCGCTCAGCTCCTTGGCTGGGG + Exonic
1141102399 16:81207619-81207641 CACCATCAGCTGCAGGGCTGTGG + Intergenic
1141517369 16:84554627-84554649 CAGCCTCCGCCTCCTGGGTGGGG - Intergenic
1141659835 16:85435873-85435895 TGGCCTCAGCTTCCTGCCTGGGG - Intergenic
1141750952 16:85957479-85957501 CACCCACCGCTGCTTGGCTGGGG + Intergenic
1142063647 16:88047417-88047439 CAAACTCAGCTTCCTGGTTTGGG - Intronic
1142425699 16:90001218-90001240 CACCCACAGGTGCATGGCTGAGG + Intergenic
1203081858 16_KI270728v1_random:1149246-1149268 CAGACTGAGCTTCCTGGGTGAGG + Intergenic
1142911545 17:3097766-3097788 CACACTAAGCTCCCTGGGTGGGG + Intergenic
1143022586 17:3924537-3924559 CATCCTCAGGTTCCTGACCGTGG - Intronic
1143272079 17:5683320-5683342 CACCATCTGCCTCCTGGCTTGGG + Intergenic
1143407765 17:6689287-6689309 CATCCTCGTTTTCCTGGCTGTGG + Intronic
1143503922 17:7353518-7353540 CACCCCAAGCTTCCTGGAGGAGG + Exonic
1144087776 17:11826343-11826365 CCCCCCCAGCTTCCGGCCTGGGG - Intronic
1144672002 17:17138166-17138188 CTCCCTCAGCTCCCTGGATGTGG + Intronic
1145776297 17:27531408-27531430 CCCCCTCAGCTTACTGTCAGGGG - Intronic
1147422763 17:40330872-40330894 CCCCCTCAGCCACCTAGCTGGGG + Exonic
1147565222 17:41531984-41532006 CACCCCCAGCTTCTTTCCTGTGG - Intergenic
1148249956 17:46068486-46068508 CAGCCTCTGCCTCCTGGCTCAGG - Intronic
1148735073 17:49860676-49860698 CACCCTCTGCTTCCTCTCAGGGG - Intergenic
1149100820 17:52904249-52904271 GACACTATGCTTCCTGGCTGGGG + Intergenic
1149161197 17:53695038-53695060 CTCCCTCTGTTTCCAGGCTGGGG - Intergenic
1149444308 17:56701763-56701785 CACCCTCTCCTTCCTTCCTGAGG - Intergenic
1150266007 17:63832870-63832892 CACCCTCTGGGTCCTTGCTGGGG - Exonic
1151158387 17:72143609-72143631 GACCCTAAGCTTCCGGGCAGCGG + Intergenic
1151522592 17:74641069-74641091 CAGCCACATCTTCCTTGCTGGGG + Intergenic
1151909279 17:77071171-77071193 CACCCTCAGCTTTCGGGAGGTGG - Intergenic
1152016806 17:77756227-77756249 CACCCTCCCTTCCCTGGCTGTGG - Intergenic
1152028468 17:77826832-77826854 CAGCCTCTGCTTCCTGAGTGGGG - Intergenic
1152325100 17:79631509-79631531 CACCTTCAGCGTCCAGACTGGGG + Intergenic
1152625439 17:81386117-81386139 AACCCTAAGACTCCTGGCTGGGG - Intergenic
1153185138 18:2477997-2478019 CAGCCTCAATTTCCTGGCTCAGG + Intergenic
1153281123 18:3415278-3415300 AACCCTCAGCTTTCTGCCTCTGG - Intronic
1154172737 18:12063064-12063086 TTCAGTCAGCTTCCTGGCTGGGG + Intergenic
1154437764 18:14360330-14360352 CACTCTCAGCTCCCAGGCGGGGG - Intergenic
1156974960 18:43209565-43209587 CCCCCTCAGCCTCCTCCCTGTGG + Intergenic
1157157450 18:45281815-45281837 CACTCTCAGCTGCATGGCAGTGG - Intronic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1158729194 18:60003873-60003895 CACCCTAAGCTCTCTGGGTGGGG - Intergenic
1158934647 18:62353501-62353523 CACACTCAGGTTTCTGGCTGAGG - Intronic
1160231786 18:77054391-77054413 CTCCCGCAGCCTCCTGGGTGTGG - Intronic
1160436114 18:78854094-78854116 CACCCTGTGCTTGCTGGGTGTGG - Intergenic
1160918458 19:1508535-1508557 CGACCTCAACTGCCTGGCTGAGG - Exonic
1161228168 19:3157604-3157626 CACCCCTATCTGCCTGGCTGGGG - Intronic
1161350562 19:3789073-3789095 CACCCACAGCTTCGTGGATCTGG + Intronic
1161357343 19:3826310-3826332 CACCCTGAGAGGCCTGGCTGAGG - Intronic
1161626375 19:5329261-5329283 CACCCTCAGACTCCTCTCTGTGG - Intronic
1161703418 19:5806587-5806609 CACCCCCAGCTTCTTGCCTTGGG + Intergenic
1162015906 19:7846394-7846416 CACCCTGGGCTTCCTGCCTCTGG - Intronic
1162128610 19:8512234-8512256 CGCCCTCAACTCCCTGGATGGGG - Intronic
1162323639 19:9985825-9985847 CACCCCCAGCTTCCTACCTTAGG + Exonic
1163175576 19:15562231-15562253 CACCCTCATCTTAGTGGCTGAGG + Intergenic
1163739937 19:19005224-19005246 CAGCCACAGCTTCATAGCTGTGG - Intronic
1164406274 19:27949629-27949651 CCCCTTGAGCTTCCTGGGTGAGG + Intergenic
1164707847 19:30333506-30333528 CATCTTCACCTTCCTGCCTGCGG + Intronic
1164777637 19:30865341-30865363 CATCCTCAGGGACCTGGCTGTGG + Intergenic
1164830401 19:31315518-31315540 CACACCCAGCTCCCTGGCAGAGG - Intronic
1165126428 19:33601050-33601072 CAGCCTGGGATTCCTGGCTGGGG + Intergenic
1166536991 19:43580651-43580673 CAACCTCAGCCTGCTGGATGTGG - Intronic
1167240290 19:48339315-48339337 CAGGCTCAGCCTCCCGGCTGGGG - Intronic
1167600259 19:50450919-50450941 CAAGCTCAACTTCCTGGGTGAGG + Exonic
1167740470 19:51322195-51322217 CCCCTTCACCTTCCTGGGTGGGG + Intronic
1167836584 19:52076952-52076974 GAACCTCGGCTTCCTGGGTGAGG - Exonic
1168604521 19:57747751-57747773 CACCCTCCGCTTCCCTGCGGAGG - Intronic
925155903 2:1648857-1648879 CATCCCCTGCTTCCTGGCCGGGG - Exonic
927700785 2:25267491-25267513 CAGCCTCAACTTCTTGGCTCAGG - Intronic
928865004 2:35906826-35906848 CCCCCTGTGCTTCCTGGGTGAGG + Intergenic
928906346 2:36372152-36372174 CACCCTCAGGTTGTTGGCTTAGG - Intronic
929169711 2:38919383-38919405 CATCCTCATCGTCCTGGCTCAGG - Exonic
929453789 2:42052666-42052688 CTCACTCTGCTTCCTGGGTGCGG - Intronic
929596474 2:43179309-43179331 GGCCCTCAGCGGCCTGGCTGGGG + Intergenic
930862624 2:56090782-56090804 CACACTTAGCTTGATGGCTGTGG - Intergenic
931721311 2:65069570-65069592 CTCCCTCAGCTTCCAGGCGTGGG - Exonic
932886581 2:75554416-75554438 CAGCCTCAGATGCCAGGCTGGGG + Intronic
932905826 2:75749986-75750008 CACTCTCCTCTTCCTGGGTGGGG - Intergenic
933237608 2:79882614-79882636 CACACTAAGCTTCCTGGGAGGGG - Intronic
934301203 2:91777438-91777460 AAGCCTCTGCTTCCTGTCTGAGG + Intergenic
934740123 2:96714364-96714386 CAGCCTCGGACTCCTGGCTGTGG - Intronic
935171209 2:100612624-100612646 CCCACAGAGCTTCCTGGCTGTGG - Intergenic
935211042 2:100939426-100939448 CACCCTCAGCTTCCTCCTTCAGG - Intronic
935845966 2:107165938-107165960 CACCCTCAGATTCCTCACCGTGG - Intergenic
936339468 2:111618380-111618402 CACGCTCAGATCCCTGTCTGGGG - Intergenic
936649903 2:114413944-114413966 CCCCTTGAGCTTCCTGGGTGAGG + Intergenic
936757423 2:115731443-115731465 CAGCCTCAACTTCCTGGCTTAGG - Intronic
936807827 2:116358606-116358628 CCCCTTGAGCTTCCCGGCTGAGG - Intergenic
936946055 2:117932081-117932103 CTCTCTGAGCTTCCAGGCTGAGG - Intronic
938136850 2:128766005-128766027 CACACTAAGCTCCCTGGGTGGGG - Intergenic
939333876 2:140799963-140799985 CTCCTTGAGTTTCCTGGCTGAGG - Intronic
939449113 2:142349480-142349502 TACATTCAGCTTCCTGGCTCTGG - Intergenic
940736420 2:157458158-157458180 CACCAGCAGCTTCCTAGTTGAGG + Intronic
942924049 2:181411323-181411345 CACACTAAGCTCCCTGGGTGGGG + Intergenic
943060038 2:183032966-183032988 CAGCCTCTGCCTCCTGGCTCAGG - Intronic
943657088 2:190521331-190521353 CATGCTCTGCTTCCTGCCTGTGG + Intronic
945831644 2:214794168-214794190 CAGCCTCAACTTCTTGGCTTGGG - Intronic
947156236 2:227164800-227164822 CCCACTCACCTTGCTGGCTGCGG - Exonic
947651103 2:231786742-231786764 GACCCTCAGCTTCAGTGCTGTGG + Intronic
947857107 2:233331480-233331502 AGCCCTCAGCTTCAAGGCTGGGG - Intronic
948335220 2:237202118-237202140 CACCCACAGCTTCTTGGTTATGG - Intergenic
948401952 2:237691603-237691625 CACGCTGAGCTTCCTGGACGCGG - Intronic
948578277 2:238967887-238967909 CTCCCTCAGCCTCCTGTCTCTGG + Intergenic
948674060 2:239586926-239586948 CATCCTTTGCTACCTGGCTGAGG + Intergenic
948866015 2:240775227-240775249 CTCCCTCAGCCGCATGGCTGAGG - Intronic
948928063 2:241112181-241112203 CACCCTCAGGGTCCTGACAGAGG + Intronic
1168819276 20:762247-762269 TCAACTCAGCTTCCTGGCTGAGG - Intronic
1169695791 20:8385428-8385450 CACGCTAAGCTCCCTGGGTGGGG - Intronic
1170841865 20:19930333-19930355 CACCGTCAGCTTCTTGTGTGTGG + Intronic
1171414524 20:24968580-24968602 CACCCTCACCATCGTGGCTCTGG - Intronic
1171414538 20:24968656-24968678 CACCCTCACCATCGTGGCTTTGG - Intronic
1171458872 20:25287292-25287314 CAACCTCAGCCTTGTGGCTGTGG - Intronic
1171469803 20:25361217-25361239 CAGACTCAGCTTCCTGTCTAGGG - Intronic
1172605297 20:36209814-36209836 CAGACTCATCATCCTGGCTGGGG - Exonic
1173618117 20:44416037-44416059 CACCCAAACCTCCCTGGCTGGGG + Intronic
1173780604 20:45753637-45753659 CAACCTCTGTCTCCTGGCTGAGG - Intronic
1174403128 20:50286701-50286723 AGCCCTCAGCCCCCTGGCTGGGG - Intergenic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1175314986 20:58040875-58040897 CACCACCTGCTCCCTGGCTGTGG + Intergenic
1175408950 20:58753434-58753456 AACCCTCTGCTGCCCGGCTGCGG + Intergenic
1175426824 20:58872797-58872819 GACCTTCAGCTTCCTGGCATTGG + Intronic
1175780929 20:61681645-61681667 CACCCTCAGCTCTGTGCCTGTGG - Intronic
1178167337 21:29994621-29994643 CAGCCTCAGCTTCCTCTCAGAGG - Intergenic
1178407624 21:32337398-32337420 CACTCTCAGCGTCCTAGGTGAGG - Exonic
1179457467 21:41508772-41508794 CAGCCACGTCTTCCTGGCTGAGG - Intronic
1179498154 21:41787903-41787925 CAGCCTCAACTTCCTGGGTTTGG - Intergenic
1179724644 21:43335379-43335401 CACCGTCCACCTCCTGGCTGTGG + Intergenic
1179996787 21:44977871-44977893 CACTCTCAGCTCCCAGGCGGGGG + Intergenic
1180763058 22:18223543-18223565 CCCTCTCAGCTCCCGGGCTGGGG - Intergenic
1180772585 22:18401004-18401026 CCCTCTCAGCTCCCGGGCTGGGG + Intergenic
1180803965 22:18650620-18650642 CCCTCTCAGCTCCCGGGCTGGGG + Intergenic
1180806798 22:18718829-18718851 CCCTCTCAGCTCCCGGGCTGGGG - Intergenic
1180815236 22:18785283-18785305 AAGCCTCTGCTTCCTGTCTGAGG - Intergenic
1180945260 22:19689029-19689051 CACCCTCTGCTCACAGGCTGCGG + Intergenic
1181096148 22:20506662-20506684 CACCTTCAACCTCCTGTCTGGGG + Intronic
1181201426 22:21219620-21219642 AAGCCTCTGCTTCCTGTCTGAGG - Intronic
1181217754 22:21344639-21344661 CCCTCTCAGCTCCCGGGCTGGGG - Intergenic
1181330135 22:22084386-22084408 CCCCCTCAGCTCTCAGGCTGGGG - Intergenic
1181700321 22:24617343-24617365 AAGCCTCTGCTTCCTGTCTGAGG + Intronic
1182150674 22:28025009-28025031 CATACCCAGCTTTCTGGCTGGGG - Intronic
1182938957 22:34255345-34255367 CACACTAAGCTCCCTGGGTGAGG - Intergenic
1183236743 22:36624441-36624463 CACCCACAGCACCCAGGCTGAGG + Intronic
1183338359 22:37264097-37264119 ACTCCTCACCTTCCTGGCTGTGG - Intergenic
1183364100 22:37398164-37398186 CGCCCACAGCTGCCTGGCTCTGG - Intronic
1183404822 22:37625210-37625232 CACCCCCAGCTCCCTCCCTGGGG - Intronic
1183817892 22:40318957-40318979 CTGCCTCAGCTTCCCGACTGAGG - Intronic
1184177086 22:42794561-42794583 GACCCTCTGCTTCCTGACTGAGG + Intergenic
1184188812 22:42881486-42881508 CGCCCTCAGCATCCCTGCTGGGG + Intronic
1184274258 22:43401221-43401243 CACTCTCAGCCGCCCGGCTGTGG - Intergenic
1184362008 22:44024422-44024444 CGCCCTCCGCTTCCTGGCCAGGG - Intronic
1185333213 22:50260826-50260848 CACCGCGGGCTTCCTGGCTGGGG + Intronic
1203225488 22_KI270731v1_random:75810-75832 AAGCCTCTGCTTCCTGTCTGAGG + Intergenic
1203234423 22_KI270731v1_random:141992-142014 CCCTCTCAGCTCCCGGGCTGGGG + Intergenic
1203265342 22_KI270734v1_random:10974-10996 AAGCCTCTGCTTCCTGTCTGAGG - Intergenic
949119967 3:373525-373547 CACGCTAAGCTCCCTGGGTGGGG - Intronic
949640470 3:6030291-6030313 CACCTTGTGCTTCCTGGGTGAGG + Intergenic
950425644 3:12923529-12923551 CACACTTAGCCTCCTGGGTGTGG + Intronic
950667466 3:14506063-14506085 CACCCTCCACTTCCTGCCTTTGG + Intronic
951286649 3:20821327-20821349 CCCCCTGTGCTTCCTGGGTGAGG + Intergenic
951826591 3:26875687-26875709 CCCCCTGTGCTTCCTGGGTGAGG - Intergenic
951964782 3:28370091-28370113 CCCCTTGAGCTTCCTGGGTGAGG + Intronic
952503814 3:33989361-33989383 CACACTAAGCTCCCTGGGTGGGG - Intergenic
953019469 3:39104471-39104493 CACCCTCAGGTCTTTGGCTGCGG + Intronic
953343530 3:42156010-42156032 CACTCTCTGCTTCCCTGCTGTGG + Intronic
954501029 3:51014107-51014129 CCCCTTGAGCTTCCTGGGTGGGG + Intronic
955484021 3:59417716-59417738 CACTCTCAGCTCTCTGGTTGGGG - Intergenic
955667294 3:61364192-61364214 CACCTTGCGCTTCCTGGGTGAGG - Intergenic
958266315 3:91441621-91441643 CATCTTCAGGTTCATGGCTGAGG - Intergenic
958656509 3:97009513-97009535 CACACTAAGCTCCCTGGATGGGG - Intronic
959620924 3:108397904-108397926 CCTCCCCAGCATCCTGGCTGTGG + Intronic
961330520 3:126135479-126135501 CACCATCAGCTTCTGGGCAGTGG - Intronic
961336090 3:126180526-126180548 CAACCTCAGTTTCGGGGCTGCGG - Intronic
961716481 3:128861152-128861174 CAATCTCAGCCTCCTGTCTGTGG + Intergenic
962691911 3:137907544-137907566 CACACTAAGCTCCCTGGCAGGGG + Intergenic
963083563 3:141416502-141416524 CACGCTAAGCTTCCTGACAGTGG - Intronic
963590105 3:147246753-147246775 CATCTTCCTCTTCCTGGCTGGGG - Intergenic
963867112 3:150373855-150373877 GGCTCTCAGCTTCCTGGCTGGGG + Intergenic
964007793 3:151852184-151852206 CACACTAAGCTTCCAGGGTGGGG - Intergenic
966762601 3:183430541-183430563 TAACCTCAGCTTCCTGGCTTAGG + Intergenic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
969059909 4:4426229-4426251 CACCCTGAGCTTCCTGAGGGCGG + Intronic
969233612 4:5849674-5849696 CATCCTCAGCTTCCTGCTTTTGG - Intronic
969409142 4:7016427-7016449 GCCCCTCAGATTCCTGGCTGGGG + Intronic
970587303 4:17526836-17526858 CATCGCCAGCTTCGTGGCTGCGG + Exonic
970982942 4:22123226-22123248 CCCCTTGAGCTTCCTGGGTGAGG - Intergenic
971220101 4:24697502-24697524 CCTCCTCAGCTTCCTGCCTCTGG - Intergenic
975893915 4:79063041-79063063 CTCCATGACCTTCCTGGCTGGGG + Intergenic
976044031 4:80923183-80923205 CCTCCTCCTCTTCCTGGCTGTGG - Intronic
976390687 4:84501174-84501196 CTCCCGCAGCTTCCTGGCCGAGG - Intergenic
976956828 4:90911686-90911708 CCCCTTGAGCTTCCTGGGTGAGG - Intronic
977219829 4:94325725-94325747 CCCCCTGTGCTTCCTGGGTGAGG + Intronic
977994379 4:103484610-103484632 CCCCTTCTGCTTCCTGGCTGAGG - Intergenic
978493985 4:109339782-109339804 CCCCTTGAGCTTCCTGGGTGAGG - Intergenic
978565444 4:110076792-110076814 CCCCTTGAGCTTCCTGGGTGAGG - Intronic
979886076 4:126029938-126029960 CCCCTTGAGCTTCCTGGGTGAGG - Intergenic
980330455 4:131403814-131403836 CTCCTTGAGCTTCCTGGGTGAGG + Intergenic
980586910 4:134829857-134829879 CCCCTTGAGCTTCCTGGGTGAGG - Intergenic
981081365 4:140642326-140642348 CACCCCTATCTTCCTGGCTTTGG + Intronic
982280205 4:153676502-153676524 CACCTTCGGCTCCCTGGCAGGGG - Intergenic
982663199 4:158229899-158229921 CACGCTAAGCTCCCTGGGTGAGG - Intronic
983299102 4:165902546-165902568 CTCCTTCTGCTTCCTGGGTGAGG + Intronic
983474683 4:168198917-168198939 CCCCTTGTGCTTCCTGGCTGAGG + Intergenic
985301162 4:188491156-188491178 CACCAACAGCATCCAGGCTGAGG - Intergenic
985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG + Intronic
986130206 5:4923155-4923177 GCCCCACAGCTTCCTGGATGTGG - Intergenic
986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG + Intergenic
986715727 5:10522251-10522273 CATTCACAGCTTCCTGGCTGAGG + Intergenic
987362509 5:17120101-17120123 CCCCCACCGCTTCCTGCCTGGGG - Intronic
988059477 5:26148796-26148818 CACGCTAAGCTCCCTGGGTGGGG + Intergenic
991425055 5:66482228-66482250 CCCCTTGAGCTTCCTGGGTGAGG - Intergenic
991535640 5:67666766-67666788 CCCCTTGGGCTTCCTGGCTGAGG + Intergenic
992277884 5:75139952-75139974 AACCTTCAGGTTCCTGGCTTTGG - Intronic
992765306 5:79992971-79992993 GACCCTCAGCTTTATGGCTTAGG - Intronic
995080645 5:108047533-108047555 CACGCTAAGCTCCCTGGGTGGGG + Intronic
995692620 5:114844605-114844627 CCCCTTCTGCTTCCTGGGTGAGG - Intergenic
995852302 5:116559262-116559284 CCCCCCAAGCTTCCAGGCTGGGG - Intronic
997096913 5:130923791-130923813 CACCCTAACCTCCCTGGGTGGGG + Intergenic
997789998 5:136750381-136750403 CACCCCAAGCTTCCTGGATCAGG + Intergenic
999085602 5:148886115-148886137 CACCTTCTACTTCCTGGCTTTGG + Intergenic
1000267104 5:159648088-159648110 CACCCTTGGCTTCCTGACTTTGG - Intergenic
1001010334 5:168091930-168091952 CACCCTCTACTTCCTGGACGTGG - Intronic
1001250667 5:170144428-170144450 CACCCTCTGCATTCGGGCTGAGG + Intergenic
1001487137 5:172127783-172127805 CATCCTGAGGTTCTTGGCTGTGG - Intronic
1001839730 5:174864878-174864900 CACGCTAAGCTCCCTGGGTGGGG - Intergenic
1002657542 5:180762598-180762620 CCCCTTGAGCTTCCTGGGTGAGG + Intergenic
1002676950 5:180924591-180924613 CACCCACATCTGCCTGTCTGAGG + Intronic
1003042135 6:2698214-2698236 CACCATCAGAGTCCAGGCTGTGG - Intronic
1004011323 6:11690735-11690757 CATGCTCAGCTTCATGTCTGAGG - Intergenic
1005886915 6:30103934-30103956 CGCCCTCTGTTTCCTGGCAGAGG + Intronic
1006387403 6:33739007-33739029 TCCCCACAGCCTCCTGGCTGGGG + Intronic
1006517518 6:34553133-34553155 CACACTAAGGTCCCTGGCTGGGG + Intronic
1006554390 6:34853023-34853045 CACCCCCAGCCTCCTGGCAGTGG - Intronic
1006554416 6:34853287-34853309 CTGCCTCAGCCTCCTGACTGAGG + Intronic
1006590071 6:35148487-35148509 CACCCTCAAATTCCATGCTGTGG + Intronic
1008439187 6:51513090-51513112 CAGCCGCAGCATCCTGCCTGAGG - Intergenic
1008934335 6:56973833-56973855 CAGCCTCAGCTTCCCAGCTCAGG + Intronic
1009186291 6:60578875-60578897 CACCTTGAGCTTCCCGGGTGAGG - Intergenic
1009410639 6:63361590-63361612 CCCCTTGAGCTTCCTGGGTGAGG + Intergenic
1010461457 6:76118700-76118722 CCCCTTCTGCTTCCTGGGTGAGG + Intergenic
1011337005 6:86272461-86272483 CGCCTTGAGCTTCCTGGGTGAGG + Intergenic
1012187826 6:96243204-96243226 CAACCTCTGCTTCCTGGCTCAGG - Intergenic
1012252304 6:96992293-96992315 CACTCACCGTTTCCTGGCTGTGG + Intronic
1013305235 6:108841503-108841525 CACCCTCAGCTGTGTGTCTGTGG - Intergenic
1013375376 6:109509606-109509628 CAGCCTCATCCTCCTGGGTGTGG + Intronic
1013505830 6:110799060-110799082 CAACCTCAACCTCCTGGCTCAGG - Intronic
1013972828 6:116041622-116041644 CCCCTTGAGCTTCCTGGGTGAGG - Intronic
1015159350 6:130135140-130135162 CAACCTCCGCCTCCTGGCAGAGG + Intronic
1016111390 6:140230013-140230035 CCCCTTGAGCTTCCTGGGTGAGG - Intergenic
1017016097 6:150100697-150100719 CACCCCCAGCTTCCAGGCCCCGG - Intergenic
1017679254 6:156846862-156846884 CACCCTCTGATTCCTGTCTTTGG + Intronic
1017928483 6:158931105-158931127 CAGCCCCAACTTCCTGGCTGGGG - Intergenic
1019003872 6:168779828-168779850 CTCCCTCAATTTCCTGCCTGTGG - Intergenic
1019559833 7:1650547-1650569 CAGCCTCATCTGCCTGGCTCGGG - Intergenic
1019702661 7:2481487-2481509 CAATCTCTGCTGCCTGGCTGGGG + Intergenic
1019733510 7:2639647-2639669 CACCCCCGGCTTCCTGGATGGGG - Intronic
1020265299 7:6556501-6556523 CATCCCCAGCTGCCAGGCTGTGG + Intergenic
1021499875 7:21320556-21320578 CAGCCTCAACTTCCCGGCTCAGG - Intergenic
1022140903 7:27492245-27492267 GACCCGGAGCTTCCTGACTGGGG + Intergenic
1023058990 7:36311660-36311682 AACCCTGAGCCTCCAGGCTGGGG + Intergenic
1023529463 7:41137286-41137308 CAACCTCAACCTCCTGGCTCAGG - Intergenic
1024054479 7:45651168-45651190 GTCACTCAGCTTCCTGGCTCTGG + Intronic
1024232124 7:47370737-47370759 CACCAGCAGCTCCCTGGCTGTGG - Intronic
1024506543 7:50167076-50167098 CTTCCTCAGCTCCTTGGCTGAGG - Intergenic
1024555397 7:50599157-50599179 CACGCTCAGCTGCATGGGTGGGG + Intronic
1027266372 7:76497172-76497194 CACCCTCTGATTCCTGGCCTGGG + Intronic
1027317752 7:76995290-76995312 CACCCTCTGATTCCTGGCCTGGG + Intergenic
1027548085 7:79555659-79555681 CAACCTCAGCTTCCATTCTGTGG - Intergenic
1027574467 7:79915248-79915270 CCCCTTGTGCTTCCTGGCTGAGG - Intergenic
1027797357 7:82711815-82711837 TACTCTCAGCTTCCTGGATTAGG + Intergenic
1028542015 7:91952930-91952952 CTGCCTCAGCCTCCTGACTGAGG + Intronic
1029745067 7:102512157-102512179 CACCATCCGCTCCCGGGCTGAGG - Intronic
1029763059 7:102611318-102611340 CACCATCCGCTCCCGGGCTGAGG - Intronic
1030313015 7:108086833-108086855 CAGCCTCAGATTCCCGGATGTGG + Intronic
1030675864 7:112384777-112384799 TACCTTCAGCTTCCTGGCCCAGG - Intergenic
1030701591 7:112646999-112647021 CACGCTCAGCTCCCTGGGAGGGG - Intergenic
1030727086 7:112939306-112939328 CAACCTCAGCACCCCGGCTGGGG + Intronic
1031040407 7:116833244-116833266 CACCCTCAGCATCTTGCCTGGGG + Intronic
1031804556 7:126292590-126292612 CACGCTAAGCTCCCTGGGTGGGG + Intergenic
1032017386 7:128388772-128388794 CAACATCAGCTTCTGGGCTGAGG - Intergenic
1032152657 7:129443470-129443492 CAGCCTCTGCTTTGTGGCTGTGG + Intronic
1032203245 7:129838718-129838740 CAACCTCTGCTTCCTGGTTCAGG + Intronic
1033290403 7:140078230-140078252 CACCTCCAGCTGCCTGACTGGGG - Intergenic
1035167214 7:156999131-156999153 AACCCTCAGCCTCCTGGGTGCGG + Intronic
1035357063 7:158282472-158282494 TGCCCGCGGCTTCCTGGCTGTGG - Intronic
1035637772 8:1160088-1160110 CGGCGTCAGCTTCCGGGCTGTGG - Intergenic
1035877468 8:3206994-3207016 CACCCTTACCATGCTGGCTGTGG + Intronic
1035917690 8:3643169-3643191 TTCCCTGAGCTTCCTGGATGTGG - Intronic
1035925148 8:3720157-3720179 CATCCCCAGCTTCCTGTGTGCGG - Intronic
1037405975 8:18542938-18542960 CACACTCAGCTTCCTTCCTTAGG + Intronic
1037719569 8:21431228-21431250 CCCCTTGAGCTTCCTGGGTGAGG - Intergenic
1037963768 8:23117956-23117978 CATCCTCAGGTTGCAGGCTGTGG - Intergenic
1040285655 8:46099205-46099227 CACCCTCACCAGCCTGCCTGTGG - Intergenic
1041217549 8:55615916-55615938 CCCCCTGCGCTTCCTGGGTGAGG - Intergenic
1042629935 8:70805498-70805520 CACGCTAAGCTCCCTGGGTGGGG + Intergenic
1048095157 8:131283994-131284016 CTACCTCAGCTCCCTGGCAGAGG - Intergenic
1048415864 8:134227103-134227125 CACCCAGAGCTGCCTGGCTTGGG - Intergenic
1049663063 8:143829075-143829097 CGGCCTCAGCTTCCGGCCTGCGG - Intronic
1050618327 9:7426468-7426490 CACGCTAAGCTCCCTGGGTGTGG - Intergenic
1052973884 9:34398163-34398185 CAGCCTCAGCTCCCTCCCTGGGG - Exonic
1054835534 9:69672127-69672149 CACCCACCCCTCCCTGGCTGTGG + Intronic
1055253338 9:74335335-74335357 CACTCCAAGCCTCCTGGCTGTGG + Intergenic
1055612650 9:78038816-78038838 CATCATCCGCTTCCTGGCTGAGG - Intergenic
1056271518 9:84952413-84952435 CACCATCAGCTCCCTGGCTTGGG - Intronic
1057214871 9:93222248-93222270 CAACCTCTGCTTCCAGGCTCAGG + Intronic
1058885763 9:109320435-109320457 GAACCGCAGCATCCTGGCTGGGG + Exonic
1059767916 9:117401243-117401265 CTCCCTCAGCTACGTAGCTGAGG - Intronic
1059889036 9:118780446-118780468 CACACCCAGGCTCCTGGCTGGGG - Intergenic
1060268763 9:122127113-122127135 CACCCCCATCTGCCGGGCTGGGG - Intergenic
1061027187 9:128057347-128057369 CAGCCACAGCCTCCTGGCGGTGG + Intergenic
1061726307 9:132583832-132583854 CCCAGGCAGCTTCCTGGCTGAGG - Intronic
1062077768 9:134601161-134601183 CTCCCTCAGCTTCTGGGCAGGGG + Intergenic
1062344277 9:136107655-136107677 CACCCTCCTCCACCTGGCTGGGG - Intergenic
1062547287 9:137069506-137069528 GGCCCTCAGCCTCCTGTCTGTGG - Intronic
1187304875 X:18085920-18085942 CAGCCTCCTCTTCCTGCCTGTGG + Intergenic
1189173952 X:38935461-38935483 CTCCCTCAGAGTCCTGGCTATGG + Intergenic
1191938667 X:66454034-66454056 CACCTTGAGCTTCCTGGGTGAGG - Intergenic
1192106472 X:68322050-68322072 CAGCCTCAACTACCTGGCTCAGG + Intronic
1192352564 X:70369183-70369205 CCCCTTCCGCTTCCTGGGTGAGG + Intronic
1192524473 X:71829840-71829862 CCCCTTGAGCTTCCTGGGTGAGG - Intergenic
1193062343 X:77220165-77220187 CACACTAAGCTCCCTGGATGGGG + Intergenic
1193091070 X:77494397-77494419 CACGCTAAGCTCCCTGGGTGGGG + Intergenic
1194227539 X:91279715-91279737 CATCCTCCCCATCCTGGCTGGGG - Intergenic
1194482916 X:94448919-94448941 CATCTTCAGCTTTCTGACTGTGG + Intergenic
1195172895 X:102286263-102286285 CAGCCTCAGCTTCCCAGATGAGG - Intergenic
1195185971 X:102400832-102400854 CAGCCTCAGCTTCCCAGATGAGG + Intronic
1195294291 X:103460479-103460501 CCCCTTGAGCTTCCTGGGTGAGG + Intergenic
1195345035 X:103940976-103940998 CCCCTTGAGCTTCCTGGGTGAGG + Intronic
1195723613 X:107891049-107891071 CCCCTTGAGCTTCCTGGGTGAGG + Intronic
1198277797 X:135112829-135112851 CAGCCTCAGCTGCCTGGCCTGGG - Intergenic
1198615639 X:138456037-138456059 CCCCTTCTGCTTCCTGGGTGAGG - Intergenic
1200096983 X:153669113-153669135 AACCCTCAGGCTCCAGGCTGGGG - Intergenic
1200249064 X:154542543-154542565 CACACCCAGCTTCCTTCCTGGGG - Intronic
1202054238 Y:20813418-20813440 CACCCTCTGCTTGTTGGTTGAGG + Intergenic