ID: 914937424

View in Genome Browser
Species Human (GRCh38)
Location 1:151993442-151993464
Sequence ACGCAAACATAAAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914937415_914937424 19 Left 914937415 1:151993400-151993422 CCGAGAGACGAGTGGGAAAGTAG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 914937424 1:151993442-151993464 ACGCAAACATAAAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 259
914937414_914937424 20 Left 914937414 1:151993399-151993421 CCCGAGAGACGAGTGGGAAAGTA 0: 1
1: 0
2: 4
3: 8
4: 126
Right 914937424 1:151993442-151993464 ACGCAAACATAAAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914937424 Original CRISPR ACGCAAACATAAAGGGAGGA GGG Intronic
902366634 1:15979384-15979406 ACAAAAATATAAAGGGGGGAGGG - Intergenic
903429836 1:23287045-23287067 AGGCAAGAAGAAAGGGAGGAGGG - Intergenic
906013860 1:42555346-42555368 AAACAAATGTAAAGGGAGGAAGG - Intronic
906053563 1:42895531-42895553 ACAAAAACATAAAGTGGGGAAGG - Intergenic
907067082 1:51494763-51494785 ACGCAGACATACAGGGAGAATGG - Intronic
907770967 1:57463054-57463076 TAGCAAACATAAAGGTAGCAAGG + Intronic
908260734 1:62337823-62337845 ACCCAAAGAGAAAGGGAGGGAGG + Intergenic
909538442 1:76764832-76764854 ACGCCATCATTAAGCGAGGAGGG + Intergenic
909554412 1:76937572-76937594 ATGCACACATAAAGGAAGGATGG + Intronic
909709880 1:78636320-78636342 ACACACAGATAAAGAGAGGAGGG + Intronic
910738581 1:90490277-90490299 ACAAAAACATAAAGTGGGGAAGG - Intergenic
910799138 1:91128409-91128431 ACCCAAACAGAAAAGGAGGGGGG + Intergenic
911661172 1:100503038-100503060 AAGCAAAGTTAAAGGGGGGAAGG - Intronic
911768883 1:101713901-101713923 AGGTTAACATGAAGGGAGGAAGG + Intergenic
911805802 1:102206575-102206597 ACAAAAACATAAAGTGGGGAAGG - Intergenic
912526925 1:110290386-110290408 ACACAGACACACAGGGAGGAAGG + Intergenic
912552290 1:110492116-110492138 GTGCAAAGAAAAAGGGAGGAGGG - Intergenic
912782962 1:112570657-112570679 AAGCAAACATAAAGGGATTTAGG - Intronic
914937424 1:151993442-151993464 ACGCAAACATAAAGGGAGGAGGG + Intronic
915161444 1:153923159-153923181 ACCCAATCATAAACGGAGGAGGG + Intergenic
917725288 1:177822015-177822037 ACTCAAACCTTGAGGGAGGAGGG - Intergenic
918688657 1:187451617-187451639 ACTCAAAGATAAAAGGTGGAAGG + Intergenic
920680478 1:208068822-208068844 ACAAATACAGAAAGGGAGGAGGG - Intronic
920801510 1:209192382-209192404 ACTCAAGTATAAAGGGAGGGGGG + Intergenic
922312240 1:224405953-224405975 AGGCAACCATAAAGGGACAATGG + Intronic
923919033 1:238543557-238543579 GATCAAACATGAAGGGAGGAAGG + Intergenic
924039171 1:239966611-239966633 ATGGAAACAAAAAGGAAGGAAGG - Intergenic
924069437 1:240261012-240261034 ACAAAAACATAAAGTGAGGAAGG - Intronic
924274099 1:242367652-242367674 ACGCAAACATAGAGGTGGGCAGG + Intronic
924602582 1:245504399-245504421 AGGAAAACATGAAGGGAGGGAGG - Intronic
924676592 1:246184711-246184733 ATGCAAGCACACAGGGAGGAAGG - Intronic
1064184177 10:13146473-13146495 ATGCACACAGAGAGGGAGGAAGG - Intergenic
1064587319 10:16851989-16852011 AGGCAAAGATAGAGGGAGGGAGG - Intronic
1064587420 10:16852356-16852378 AGGCAAAGATAGAGGGAGGGAGG - Intronic
1064587458 10:16852516-16852538 AGGCAAAGATAGAGTGAGGAAGG - Intronic
1064907731 10:20365752-20365774 ACAAAAACATAAAGTGTGGAAGG - Intergenic
1065497393 10:26343306-26343328 ACACACACACACAGGGAGGATGG + Intergenic
1066290237 10:34007832-34007854 ATGGAAGCATATAGGGAGGAAGG - Intergenic
1066983524 10:42441938-42441960 ACTAAAACATAAAGTGAAGAAGG + Intergenic
1069629871 10:69890981-69891003 AGGGAAACAGAAAGGGAGGAAGG - Intronic
1070824395 10:79382279-79382301 ACGCAAGCATGTAGGGAGGCTGG - Intergenic
1071155450 10:82683279-82683301 AAGGAAAGATAAAGGGAGGGAGG - Intronic
1072390522 10:94981030-94981052 ATGCAAACTTAAAGAGAGGATGG - Intronic
1072921162 10:99578457-99578479 ACGCACAAACAAAGCGAGGAAGG - Intergenic
1074331698 10:112518368-112518390 AGGGAAGCATAAAGAGAGGATGG + Intronic
1074465504 10:113678405-113678427 AAGCAAACAGAAAGAGAAGATGG + Intergenic
1076623675 10:131808843-131808865 AGGCACAGATAGAGGGAGGATGG - Intergenic
1077780505 11:5323818-5323840 ACGCAAAATTACAGGCAGGATGG + Exonic
1077959961 11:7065132-7065154 ACGCCAACATATAGGTAGGTTGG - Intronic
1078570765 11:12456152-12456174 ACGCATACATACTGGGAGGGAGG - Intronic
1078758144 11:14230775-14230797 ACGAAAAAATGAAGGAAGGAAGG - Intronic
1080582723 11:33657141-33657163 AAGCAAGCAGAGAGGGAGGAAGG + Intronic
1080701653 11:34649464-34649486 ACACACCCATCAAGGGAGGAGGG - Intronic
1081163043 11:39775023-39775045 ACCCAAAAATAAAAGGAGTAGGG - Intergenic
1081254838 11:40879595-40879617 ACTCACAGATAAAGGGAGGATGG + Intronic
1081539590 11:44021878-44021900 ACAAAAACATAAGGTGAGGAAGG - Intergenic
1081618124 11:44602607-44602629 GCCCAAACAGAAAGGGATGAGGG - Intronic
1083583725 11:63841113-63841135 AGGGAAACATAAAGGATGGAAGG - Intronic
1084422612 11:69067862-69067884 ATGAAAAGAAAAAGGGAGGAGGG - Intronic
1084868009 11:72075598-72075620 ACTGAAAAACAAAGGGAGGAAGG - Intronic
1085654554 11:78301194-78301216 ACACACACATAATGGGAGCAAGG + Intronic
1085789812 11:79487277-79487299 ATGCAAATATAAAGAAAGGAAGG - Intergenic
1088615933 11:111628224-111628246 ACACAAACAGAAAGAAAGGAAGG - Intronic
1089095545 11:115917188-115917210 ACGAAAACAGAAAGGAAGGGAGG - Intergenic
1091007609 11:131967575-131967597 AGGCAGAGATAAAGGGAAGAAGG + Intronic
1092071348 12:5633911-5633933 AGGCATGCATATAGGGAGGAGGG - Intronic
1092462799 12:8700593-8700615 AACCAAACATAAAGTAAGGAGGG + Exonic
1092929775 12:13305003-13305025 ACGCACACACACAAGGAGGAGGG - Intergenic
1093195441 12:16125006-16125028 AGGAAAACAGAAAGGGAGGGAGG - Intergenic
1094446914 12:30541042-30541064 ACAAAAACATAAAGTGGGGAAGG - Intergenic
1094522230 12:31204199-31204221 AGGCAAACATAAAGAGAGGTAGG - Intergenic
1096253163 12:50046317-50046339 ATGCATAAATAAGGGGAGGAAGG + Intergenic
1097317817 12:58191036-58191058 ATGCAAAAACAAAGGGATGATGG - Intergenic
1099048594 12:77755478-77755500 AGGGAAAGAGAAAGGGAGGAAGG - Intergenic
1100643269 12:96503154-96503176 AGGAAAAAATAAAGGGAGGGAGG - Intronic
1102194897 12:111018156-111018178 AGGCAAAGAGAAAGAGAGGAAGG + Intergenic
1104841764 12:131829067-131829089 ACGCACCCACAAAGCGAGGAAGG + Intronic
1105727260 13:23176811-23176833 AGGTAAACAACAAGGGAGGAAGG - Intergenic
1109002292 13:56820808-56820830 ACAAAAACATAAAGTGAGAAAGG - Intergenic
1109567525 13:64136681-64136703 ACACAAAAATAAAGTCAGGATGG + Intergenic
1112569067 13:100577631-100577653 TCCAAAACACAAAGGGAGGAGGG + Intronic
1113599242 13:111556640-111556662 ACGCAGACATAAGGGGAAGGTGG - Intergenic
1114401758 14:22416661-22416683 AAACAAACATAATGGGAAGAGGG - Intergenic
1114864689 14:26574671-26574693 AAACAAACAAAAAGGGTGGAGGG - Intronic
1115118675 14:29913497-29913519 AAGTAAACATAGAGTGAGGATGG - Intronic
1115157966 14:30361651-30361673 AGGCAAACAGAAAGGGTGCAGGG + Intergenic
1115544025 14:34448707-34448729 ACGCACAAACAAAGCGAGGAAGG - Intronic
1115604912 14:34991508-34991530 AGGAAAAAATAAAGGGAAGAGGG + Intronic
1115718827 14:36137143-36137165 GCAGAAACACAAAGGGAGGAAGG + Intergenic
1116010618 14:39347391-39347413 AGGCAAACATAAAAGGAGGGAGG + Intronic
1116228400 14:42182944-42182966 AAGCAAAGAAAGAGGGAGGATGG - Intergenic
1116324789 14:43518933-43518955 ACAAAAACATAAAGTGGGGAAGG + Intergenic
1119031681 14:71197515-71197537 AAGCCAACAGACAGGGAGGAAGG - Intergenic
1120599270 14:86480838-86480860 ATGTAAACAAAAAGGGAAGATGG - Intergenic
1121226658 14:92326260-92326282 CCGCAAACATCAAGAGAGCAGGG - Intronic
1124028804 15:25990516-25990538 ACGCTAAAAGAAATGGAGGAAGG - Intergenic
1125156970 15:36598668-36598690 AGGAAAATAGAAAGGGAGGAAGG - Intronic
1126193437 15:45903517-45903539 AGGCAAGAAGAAAGGGAGGAAGG - Intergenic
1126441413 15:48693646-48693668 AAGCAAATATAAATAGAGGAAGG - Intergenic
1128581951 15:68817281-68817303 AGGCAAAAATAAAAGGGGGAAGG + Intronic
1129665628 15:77577987-77578009 AGGCAGAGATAGAGGGAGGAGGG + Intergenic
1130086511 15:80781952-80781974 ATGCAAAAATAAAGTGAAGATGG - Intronic
1130372811 15:83300884-83300906 ATGCAAAGAAAAAGGGAGCATGG - Intergenic
1131088226 15:89596734-89596756 CCCCAAAAATAAAGGTAGGAAGG - Intronic
1132033798 15:98462355-98462377 ACAAAAACATAAAGTGAGAAAGG + Intronic
1132805347 16:1772722-1772744 ACGCAAACCTGCAGGGAGGAGGG + Intronic
1133062758 16:3185474-3185496 AGGCATACACAAAGGGAAGATGG + Intergenic
1133998773 16:10766666-10766688 ACGCACAAAGAAAGGAAGGAAGG + Exonic
1137669679 16:50271943-50271965 ACAGGGACATAAAGGGAGGATGG - Intronic
1138009511 16:53364368-53364390 AAGAAAAAATAAAGGGAAGATGG - Intergenic
1138782078 16:59800797-59800819 ACCAAAACATAAAGTGGGGAAGG + Intergenic
1140543764 16:75786027-75786049 AAGCATAGATGAAGGGAGGAAGG - Intergenic
1140770420 16:78198720-78198742 TTACAAACATAATGGGAGGAAGG - Intronic
1144571441 17:16402208-16402230 GCGCAAACCTATAGGTAGGAGGG + Intergenic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1149864573 17:60143796-60143818 AGGCAAGCAGAAAGGAAGGAAGG - Intergenic
1151310489 17:73289708-73289730 AAGAAAACAGGAAGGGAGGAAGG + Intronic
1153890425 18:9509292-9509314 ACGCAAAAATATTGAGAGGAAGG + Intronic
1154493105 18:14936365-14936387 AAGCAAGCAAAGAGGGAGGAAGG - Intergenic
1155254401 18:23982171-23982193 AGGGAAAAAGAAAGGGAGGAAGG + Intergenic
1155801483 18:30110058-30110080 ACTCAAATAAAAAGGAAGGACGG + Intergenic
1156095627 18:33528132-33528154 ACCAAAACATAAAGTGGGGAAGG - Intergenic
1156107193 18:33677614-33677636 ACGAAAACATGCAGGTAGGAAGG - Intronic
1156344425 18:36242836-36242858 CCCCACTCATAAAGGGAGGAAGG - Intronic
1156482691 18:37446063-37446085 CCGCAAGCATGAGGGGAGGATGG - Intronic
1158370635 18:56798952-56798974 AGGGAAAGAAAAAGGGAGGAAGG - Intronic
1160032293 18:75272455-75272477 GCTAAAACTTAAAGGGAGGAAGG + Intronic
1160471891 18:79143100-79143122 AGACAGACAGAAAGGGAGGAAGG + Intronic
1166248296 19:41546574-41546596 AAGAAATCATAGAGGGAGGAGGG - Intergenic
1167849634 19:52191468-52191490 AAACAGACCTAAAGGGAGGATGG - Intronic
925790048 2:7475457-7475479 ACACACACACAGAGGGAGGATGG + Intergenic
926162194 2:10496811-10496833 AGGCAAGCATAGAGGCAGGAGGG - Intergenic
928285988 2:29990465-29990487 AAGAAAGCAGAAAGGGAGGAAGG + Intergenic
928714222 2:34042032-34042054 AAGTAACCATAAAGGGAGTAGGG - Intergenic
928718723 2:34094677-34094699 ACACAAAAATCAATGGAGGAAGG - Intergenic
930287235 2:49445929-49445951 AAGCAAAAATAAAGAGAGAAAGG + Intergenic
932360056 2:71097375-71097397 AAGGAAAAATAAAGGAAGGAAGG + Intergenic
933379479 2:81524555-81524577 AGGAAAAGAAAAAGGGAGGAAGG - Intergenic
934700690 2:96437615-96437637 CCCCACACATCAAGGGAGGAAGG + Intergenic
936096363 2:109533133-109533155 TCTAAAACAGAAAGGGAGGAAGG + Intergenic
936997743 2:118433111-118433133 AGGAAAAAATAAAGGAAGGAAGG + Intergenic
937206478 2:120239915-120239937 GCTCAAACACAAAGAGAGGATGG + Intergenic
938037609 2:128048521-128048543 ACAAAAACATAAAGGGGGGAAGG - Intergenic
938645887 2:133329559-133329581 AAAGAAACAGAAAGGGAGGATGG + Intronic
939487716 2:142836485-142836507 CAGCAAATATAAAGGCAGGAAGG - Intergenic
940554775 2:155209900-155209922 AAGGAAACAGAAAGGAAGGAAGG + Intergenic
942269532 2:174260239-174260261 ACCTAAAAATCAAGGGAGGACGG + Intergenic
942282079 2:174375813-174375835 ACGCAAACATAAAGGAGCAAAGG - Intronic
942849969 2:180472806-180472828 AGGCAAGGAGAAAGGGAGGAAGG - Intergenic
943654686 2:190495724-190495746 ACAGAAACATAAAGGGGGAAAGG + Intronic
944737109 2:202577207-202577229 AGGGAAAGAGAAAGGGAGGAAGG + Intergenic
945879481 2:215311631-215311653 CAACAAACAAAAAGGGAGGATGG + Intergenic
946308144 2:218867775-218867797 AAGGAAGCATAAAGCGAGGAAGG + Intronic
947632132 2:231660897-231660919 AGGAAAAAATAAAGGGAGGGAGG + Intergenic
1169547519 20:6665715-6665737 AGGAAAAAATGAAGGGAGGAAGG - Intergenic
1170127441 20:12980045-12980067 AGGAAAAAATAAAGGGAAGAAGG + Intergenic
1170472444 20:16681768-16681790 AAGCAAACATGAAAGGAAGATGG + Intergenic
1173946418 20:46954352-46954374 AGGGAAACAGACAGGGAGGAAGG + Intronic
1175327634 20:58140746-58140768 ACACAAACACACAGGGAAGAAGG - Intergenic
1177297974 21:19201848-19201870 AACAAAACATCAAGGGAGGATGG - Intergenic
1179938592 21:44622630-44622652 ACACACACACAAAGGGAAGACGG - Intronic
1181884748 22:26011398-26011420 ATGAGAACATGAAGGGAGGAGGG + Intronic
1182730963 22:32492875-32492897 ACTAAAACATAAAGGGAATAAGG + Intronic
952433270 3:33246887-33246909 AAGAAAAAATGAAGGGAGGAAGG - Intergenic
952855488 3:37767088-37767110 ACGCAAAGGAAGAGGGAGGAGGG + Intronic
952919192 3:38273388-38273410 ACGCACACACAGAGGGAGGGAGG - Intronic
955718441 3:61856006-61856028 AGGAAAACATGATGGGAGGAAGG - Intronic
956099654 3:65754085-65754107 AAGCAAACAGAAAATGAGGATGG - Intronic
956183468 3:66539762-66539784 AGGCAGACAGAAAGGAAGGAAGG + Intergenic
956795993 3:72719315-72719337 AAGCAAAGAGAAAGAGAGGAAGG + Intergenic
959561241 3:107784650-107784672 AAGCAAACTTAGAGGGAGAAGGG + Intronic
959934156 3:112012302-112012324 ACACAAACAAAAAAGAAGGAAGG - Intronic
960195880 3:114767583-114767605 AAGGAAACAGAAAGGGAGGAGGG + Intronic
960264781 3:115608058-115608080 ACAAAAACATAAAGTGAAGAAGG - Intergenic
960533823 3:118794844-118794866 TGGCAAACATAAAGGGAGGGTGG + Intergenic
960558168 3:119052424-119052446 AAGCAAACAGGAAGGGAGGGAGG + Intronic
961845222 3:129757258-129757280 AAGGAAAGAAAAAGGGAGGAAGG - Intronic
962192268 3:133323906-133323928 ACAAAAACATAAAGTCAGGAAGG + Intronic
964408980 3:156378863-156378885 ACCCAAAAACAGAGGGAGGAGGG + Intronic
965120123 3:164543491-164543513 AGGCAAACAGAAAGACAGGAAGG + Intergenic
965290817 3:166877080-166877102 CCAAAAACATAAAGGGAAGAGGG - Intergenic
966071400 3:175883595-175883617 ACTCAAAAATAAAAGGAAGAAGG - Intergenic
966196450 3:177318895-177318917 ACTCAACCAAAAAGGGAAGAGGG - Intergenic
967116644 3:186347020-186347042 ATGCAAACAAAAAGAAAGGAGGG - Intronic
969917483 4:10504937-10504959 AGGCACACAGAAAGAGAGGAAGG + Intronic
970268764 4:14319842-14319864 ACACACACAGAAAGAGAGGAAGG + Intergenic
970759372 4:19465785-19465807 ACCCAAACATGCAGGAAGGAGGG + Intergenic
971754392 4:30688746-30688768 ACTCAGAGATAAAGGGAAGAAGG - Intergenic
974167795 4:58226224-58226246 ACTCAAAAACAAAGGAAGGATGG + Intergenic
974813158 4:66972014-66972036 AAACAAAAATAAAGGAAGGAAGG - Intergenic
976053024 4:81030931-81030953 TCCCAAAAATAAAGCGAGGAGGG + Intergenic
977090057 4:92661128-92661150 ACACAAGCAGAAAGGGAGAATGG + Intronic
977449012 4:97170802-97170824 AAGCAAACATTAAGGGAGTGAGG - Intergenic
977946105 4:102915992-102916014 AGTGAAACATAAAGGGAGGCAGG + Intronic
978130618 4:105191988-105192010 AAGCAATCATCAAGGGAGGAGGG - Intronic
980080293 4:128337227-128337249 AAGCAAACATAAAGGGGGAAAGG + Intergenic
980328290 4:131377017-131377039 ACGCACAAACAAAGTGAGGAAGG - Intergenic
981046107 4:140266801-140266823 AAGAAAATAAAAAGGGAGGAAGG + Intronic
981267551 4:142804573-142804595 AAGCAAACATACAAGGAGAAAGG - Intronic
981295699 4:143128310-143128332 AGGCAAGCATATAGGGAGAATGG + Intergenic
981567111 4:146113453-146113475 ACGCACACATAGAGGTAGGCAGG - Intergenic
983729403 4:170974984-170975006 ACAAAAACATAAAGTGGGGAAGG - Intergenic
984883853 4:184432731-184432753 ACACAGACACAGAGGGAGGATGG + Intronic
988665840 5:33326509-33326531 AAGCAAAATGAAAGGGAGGAAGG - Intergenic
989028868 5:37096286-37096308 ACGAAAACATAAAGGGGGAAAGG + Intergenic
992759979 5:79942982-79943004 ACACAGACACAAAGGGATGAAGG - Intergenic
993512294 5:88786123-88786145 ACACACACACAAAGGGAGGAGGG + Intronic
993992727 5:94679751-94679773 CCCCTAAAATAAAGGGAGGAAGG + Intronic
994398743 5:99252131-99252153 ACAAAAACATAAAGTGGGGATGG - Intergenic
994768025 5:103945861-103945883 ACACACACATATTGGGAGGAAGG + Intergenic
995314951 5:110759210-110759232 AAGCAAAAATAAAGCAAGGAAGG + Intronic
995913703 5:117217897-117217919 ACACAAAGAAAAAGCGAGGAAGG - Intergenic
996581941 5:125040687-125040709 AACAAAACATAAAGGGAGGCCGG - Intergenic
997749806 5:136333145-136333167 ACTCACTGATAAAGGGAGGAAGG + Intronic
998262998 5:140645330-140645352 AAGCAAACATGAAGGGTGGCGGG - Exonic
1002932543 6:1644365-1644387 ACGCCAACAGGAAGGCAGGAAGG - Intronic
1004385611 6:15170211-15170233 ATACATTCATAAAGGGAGGAAGG - Intergenic
1004779060 6:18885053-18885075 AGAGAAACAGAAAGGGAGGAAGG - Intergenic
1005493111 6:26365039-26365061 ACACAAACACTAAGGGAGGTAGG + Intergenic
1006917420 6:37603436-37603458 AGGCAAACATAATGGGGGCAGGG - Intergenic
1007593817 6:43039267-43039289 ACAAAACCATGAAGGGAGGAAGG + Intronic
1009422346 6:63477839-63477861 CTGCAAACAAAAAGGGATGAAGG - Intergenic
1011893764 6:92198699-92198721 AAGGAAACAAAAAGGGAAGAGGG + Intergenic
1012278568 6:97302038-97302060 ACACAAAGAGAAAGGGAGGGAGG - Intergenic
1012638844 6:101582733-101582755 ATACACACATAAAGGGAGTAAGG + Intronic
1016167372 6:140963418-140963440 ACAAAAACATAAAGTGGGGAAGG - Intergenic
1016582758 6:145647654-145647676 AAGCAAATACAAAGGAAGGAAGG + Intronic
1017143076 6:151209393-151209415 AATCAAGGATAAAGGGAGGAAGG + Intergenic
1017443108 6:154482825-154482847 ACGGAAAGATAATGGGGGGAAGG + Intronic
1017578389 6:155832396-155832418 AAGCAAAGAAAAAAGGAGGAAGG - Intergenic
1019608804 7:1924806-1924828 ACTACAACATAAAGGGAGGCAGG + Intronic
1023307667 7:38848420-38848442 AGGCAAACTGAAAGGGAGGTAGG - Intronic
1023355710 7:39365270-39365292 ACAAAAACATAAAGTGGGGAAGG + Intronic
1024654825 7:51442725-51442747 AGGCAATCATAAAGGGTGAAGGG + Intergenic
1024847460 7:53663836-53663858 ACAAAAACATAAAGTGGGGAAGG - Intergenic
1026546566 7:71328143-71328165 ACTCGAAGATAAAGAGAGGAAGG - Intronic
1026865537 7:73821909-73821931 AAGAAAGCATAAAGGGAGGGAGG + Intronic
1027700897 7:81469059-81469081 GAGGAACCATAAAGGGAGGAAGG + Intergenic
1028260201 7:88655095-88655117 ACTCTAACATATAGGGAGGAGGG - Intergenic
1028439898 7:90848036-90848058 AAACAAACAGAATGGGAGGAAGG - Intronic
1028559852 7:92162363-92162385 GCTCAAAAAAAAAGGGAGGAGGG - Intronic
1029729582 7:102430613-102430635 AAGGAAAGAAAAAGGGAGGAAGG + Intergenic
1030298947 7:107956277-107956299 ATGAAAACATAAAGAGAGGTGGG - Intronic
1030982300 7:116200548-116200570 AGACAAACATAAAGAGAAGATGG + Intergenic
1030996889 7:116370530-116370552 ACACAGACACACAGGGAGGAAGG + Intronic
1033623328 7:143082772-143082794 ACAAAAACATAAAGTGAGAAAGG + Intergenic
1033639555 7:143248326-143248348 AGGGAAAGATGAAGGGAGGAAGG - Intronic
1036544282 8:9751088-9751110 AGGCATACATGACGGGAGGAAGG + Intronic
1037374887 8:18217025-18217047 TCGCATACAAAAAGGGAGAAAGG + Intronic
1039176830 8:34818038-34818060 ACACAAAGACACAGGGAGGAAGG + Intergenic
1040889635 8:52303329-52303351 ACACAAACATAAAGGGACGAAGG - Intronic
1042431787 8:68715006-68715028 ACAAAAACATAAAGTGGGGAAGG + Intronic
1044205601 8:89489371-89489393 ACACAAAAATAAAGGAAGGAAGG + Intergenic
1045470607 8:102509006-102509028 ACACAATCATCATGGGAGGAAGG - Intergenic
1045838923 8:106557094-106557116 GAGCAAACACAAAGGGAGAAAGG - Intronic
1047830644 8:128626172-128626194 ACCCAAAGATAAAGAGTGGAAGG + Intergenic
1048127017 8:131647035-131647057 AGGCAGACAGAAAGGAAGGAAGG + Intergenic
1050113755 9:2242276-2242298 ATGCAAAAAGAAAGGGTGGAAGG + Intergenic
1050169415 9:2799806-2799828 CAGCAGACATAAAGGGAGAATGG + Intronic
1050471449 9:5995346-5995368 ACTGAAACATAAAGTAAGGATGG - Intronic
1055310018 9:74969192-74969214 ACAAAAACATAAATTGAGGAAGG + Intergenic
1057504417 9:95620772-95620794 CCACAAAAATGAAGGGAGGAGGG + Intergenic
1057514495 9:95710235-95710257 ACGAAAACATAAGCAGAGGAAGG + Intergenic
1057707106 9:97402944-97402966 ACAGCAACATAAAGGTAGGAGGG - Intergenic
1059903921 9:118960560-118960582 ATGCAAAGAAAAAGAGAGGAAGG - Intergenic
1185491713 X:522851-522873 AAGAAAACAGAAAGGAAGGAAGG - Intergenic
1186322595 X:8445834-8445856 CAGCAAAGATAAAGTGAGGATGG + Intergenic
1186544158 X:10431691-10431713 AGGGAAACAAAAAGGAAGGAAGG - Intergenic
1190156348 X:47996210-47996232 ACAAAAACATAAAGGGGAGAGGG + Intronic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190394925 X:49972350-49972372 ACACAAAAACAGAGGGAGGAAGG - Intronic
1191629274 X:63303867-63303889 ACAAAAACATAAAGTGAGAAAGG - Intergenic
1193065467 X:77254586-77254608 ACTAAGTCATAAAGGGAGGAAGG + Intergenic
1193779512 X:85685290-85685312 ACAAAAACATAAAGTGGGGAAGG + Intergenic
1193930989 X:87551783-87551805 ACAAAAACATAAAGTGGGGAAGG + Intronic
1196907342 X:120450611-120450633 AGACAAACATAAAGACAGGAAGG + Intronic
1197156411 X:123274675-123274697 AAGCAAACATCAAGGTGGGATGG + Intronic
1197171954 X:123444441-123444463 AGGCAAAGAGAAAGGGAGTAAGG - Intronic
1199514771 X:148663874-148663896 ATGGGAACATAAAGGGAGGGAGG + Intronic
1200319991 X:155177863-155177885 ACTATAACATAAAGGGAAGAAGG - Intergenic