ID: 914939369

View in Genome Browser
Species Human (GRCh38)
Location 1:152009012-152009034
Sequence GACTCCTAGACAATAACATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 823
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 772}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914939369 Original CRISPR GACTCCTAGACAATAACATA GGG (reversed) Intergenic
900355193 1:2258168-2258190 CATTCCAAGACAATAACATCTGG - Intronic
901262018 1:7879042-7879064 GACTCCAATACAATAACAGTTGG + Intergenic
902966166 1:20004762-20004784 GACTCCTACACAATAATAATGGG + Intergenic
905100262 1:35514771-35514793 GACTCCCACACAATAACAGTGGG + Intronic
907015445 1:51007761-51007783 GACTCCCACACAATAACAGTGGG + Intergenic
907174045 1:52501001-52501023 AACTCCTAGAAAAAAACAGAAGG + Intronic
907495118 1:54838666-54838688 GACTCATGAACAATAACAAATGG - Intronic
908352440 1:63299692-63299714 GTCTTCTAGACAATATGATAAGG + Intergenic
908724789 1:67163905-67163927 CACTCCTAGAATAAAACATAGGG + Intronic
909080748 1:71109017-71109039 GACTCCCAGACAATAATAATGGG - Intergenic
909705692 1:78581106-78581128 AACTCCTAGAAGAAAACATAGGG - Intergenic
910084763 1:83386869-83386891 AACTCCTTGAAGATAACATAGGG + Intergenic
910110723 1:83680207-83680229 AACTCCTAGAAGAAAACATAGGG - Intergenic
910744029 1:90553632-90553654 GACTCCCACACAATAATAAAGGG + Intergenic
910786148 1:91000068-91000090 GACTCCCACACAATAATAAAGGG + Intronic
910812953 1:91256411-91256433 GACTCCCACACAATAACAGTTGG + Intergenic
910940872 1:92532315-92532337 GACTCCTACACAATAATAGTGGG + Intronic
910954306 1:92684935-92684957 GACTCCTACACAATAATAATGGG + Intronic
911079457 1:93914231-93914253 GACTCCCACACAATAACAATGGG - Intergenic
911691787 1:100843232-100843254 GACTCCCACACAATAATATTGGG - Intergenic
912773134 1:112483518-112483540 AACTCCTAGAAGAAAACATAGGG + Intronic
912971791 1:114290477-114290499 GACTCCAAGCCAAATACATAGGG - Intergenic
913418749 1:118640268-118640290 GACTCCCACACAATAATAAAGGG + Intergenic
914939369 1:152009012-152009034 GACTCCTAGACAATAACATAGGG - Intergenic
915845911 1:159264877-159264899 GACTCCTAGAAGAAAACATAGGG - Intergenic
915876778 1:159618923-159618945 GACTCCTACACAATAACAGTGGG + Intergenic
915973466 1:160370214-160370236 AACTCCTAGAAGAAAACATAGGG - Intronic
916033199 1:160896637-160896659 GACTCCCACACAATAATATTGGG + Intergenic
916276863 1:163003682-163003704 AACTCCTAGAAGAAAACATAGGG - Intergenic
916411038 1:164547229-164547251 GAGTCCTAGACACAAACACAAGG - Intergenic
916543612 1:165781618-165781640 GACTCCTACACAATAATAATGGG - Intronic
916621323 1:166501077-166501099 GACTCCCACACAATAATATTGGG - Intergenic
916706980 1:167361288-167361310 AACTCATAGCCAATATCATATGG - Intronic
917582071 1:176389335-176389357 GACTCCCAGACAATAATAGTTGG - Intergenic
917991235 1:180381246-180381268 GACTCCAATACAATAACAATTGG + Intronic
918620814 1:186602800-186602822 GACTCCTAGAAAAAAAAATTAGG - Intergenic
918760627 1:188400788-188400810 CACTACTAGACAAAAACACAGGG + Intergenic
919089781 1:192964265-192964287 AATTACTAGACAAAAACATAGGG + Intergenic
922115775 1:222612346-222612368 GACTCTTAGAAAAAAACATAGGG - Intergenic
923138210 1:231137213-231137235 AACTCCTAGAAAAAAACATAGGG - Intergenic
923416511 1:233767762-233767784 GACTCCTACACAATAATAATGGG - Intergenic
923421972 1:233824778-233824800 GACTCCCACACAATAACAGTGGG + Intergenic
923707762 1:236358982-236359004 GACTCCCACACAATAATATTGGG - Intronic
923947261 1:238901669-238901691 GACTCCCACACAATAACAACGGG + Intergenic
924298756 1:242615134-242615156 GACTCCCAGACAATAATAATGGG + Intergenic
924629861 1:245726550-245726572 GACTCCCACACAATAACAGTGGG + Intergenic
924883932 1:248191493-248191515 GACTCCCATACAATAACAGTGGG + Intergenic
924886223 1:248220219-248220241 GACTCCCAGACAATAATAGTGGG - Intergenic
1063143920 10:3279261-3279283 TACATTTAGACAATAACATAGGG + Intergenic
1063831635 10:9960107-9960129 GACTCCTACACAATAATAATGGG + Intergenic
1064353506 10:14598270-14598292 AACTCCTAGAAGAAAACATAGGG - Intronic
1064431296 10:15272422-15272444 GACTCCCACACAATAATATTGGG + Intronic
1064766544 10:18680607-18680629 TACTCCAAGAGAATAAAATAGGG - Exonic
1064809613 10:19180612-19180634 AACTCCTAGAAGAGAACATAGGG + Intronic
1064844965 10:19641624-19641646 GACTCCAAGAATATAACAAACGG - Intronic
1065120372 10:22524151-22524173 GACTCCCACACAATAACAGTGGG - Intergenic
1065165473 10:22972279-22972301 AACTCCTAGAAGAAAACATAGGG - Intronic
1065406394 10:25370779-25370801 GACTCCCACACAATAACAATGGG - Intronic
1065601164 10:27370141-27370163 GACTCCTAGACTATAAAACTAGG + Intergenic
1066158751 10:32705849-32705871 GACTCCCACACAATAACAATGGG + Intronic
1066173021 10:32872217-32872239 GACTCCCACACAATAACAATGGG - Intronic
1066181557 10:32966737-32966759 AACTCTTAGAAAACAACATAGGG + Intronic
1066621827 10:37363488-37363510 AACTCCTAGAAGATAACATAGGG - Intronic
1066699129 10:38107883-38107905 GACTCCTACACAATAATAGTGGG + Intronic
1067023633 10:42824580-42824602 AACTCCTAGAAGAAAACATAGGG - Intronic
1067336478 10:45369999-45370021 AACTCCTAGAGAGAAACATAGGG + Intergenic
1068053329 10:51980591-51980613 GACTCCAACACAATAACAATGGG - Intronic
1068085843 10:52372838-52372860 GACTCCTACACAATAACAATAGG - Intergenic
1068472900 10:57487995-57488017 GACTCCCACACAATAACAGTGGG - Intergenic
1068479089 10:57566160-57566182 AACTCCTAGAGGAAAACATAGGG - Intergenic
1068495577 10:57781364-57781386 GACTCCTACACAATAATAATGGG + Intergenic
1069161825 10:65102274-65102296 GACTCCCACACAATAACAATGGG + Intergenic
1069188782 10:65462036-65462058 GACTCCCACACAATAATAAAGGG - Intergenic
1069322672 10:67192126-67192148 AACTCCTAGAAGAAAACATAGGG + Intronic
1069488349 10:68840217-68840239 GACTCCTAGAAGAGAACATGGGG + Intronic
1070082005 10:73198248-73198270 AACTCCTAGAATAAAACATAGGG + Intronic
1071028007 10:81138812-81138834 GACTCCCACACAATAATATTAGG + Intergenic
1071448507 10:85771852-85771874 GACTCCCACACAATAACAGTGGG + Intronic
1071946296 10:90649022-90649044 GACTCCTACACAATAATAATGGG - Intergenic
1071975607 10:90952912-90952934 GACTCCCACACAATAATATTGGG - Intergenic
1072871516 10:99125404-99125426 GGCTCCTAGACTATAATATTAGG + Intronic
1072872542 10:99135237-99135259 GACTCCCACACAATAACAGTCGG + Intronic
1073751780 10:106537099-106537121 GAATCCTAATAAATAACATATGG + Intergenic
1075205867 10:120447581-120447603 GACTCCTACACAATAATAATGGG + Intergenic
1075281852 10:121145653-121145675 GACTCCTACACAATAATAGTGGG - Intergenic
1075562759 10:123480421-123480443 GACTGCTAGAAAGCAACATATGG + Intergenic
1077686937 11:4301875-4301897 GACTCCTACACAATAAGAATGGG - Intergenic
1078284071 11:9933189-9933211 GACTCCTACACAATAATAATGGG + Intronic
1078813833 11:14799543-14799565 GACTCCTACACAATAATAGTGGG - Intronic
1078977034 11:16489451-16489473 GAATCCTAGACAACAGCATGAGG + Intronic
1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG + Intergenic
1079397147 11:20074544-20074566 GACTCCCACACAATAACAGTGGG - Intronic
1079516412 11:21274429-21274451 GACTCCCACACAATAACAATGGG + Intronic
1079549657 11:21678607-21678629 AACTCTTAGAAAAAAACATAGGG - Intergenic
1079864862 11:25722352-25722374 GACTCCCAGACAATAATAATGGG - Intergenic
1080513475 11:32998912-32998934 GACTCATACACAATAATAGAGGG - Intergenic
1080650421 11:34218399-34218421 AACTCCTAGAAGATAACATGGGG - Intronic
1080933158 11:36834958-36834980 GACAGCCACACAATAACATAGGG - Intergenic
1081166310 11:39812514-39812536 GACTCCCACACAATAACAGTGGG + Intergenic
1081377746 11:42379332-42379354 GACTCCCACACAATAACAATGGG + Intergenic
1082118072 11:48348509-48348531 GACTCCCACACAATAACAATGGG + Intergenic
1082599817 11:55135221-55135243 GACTCCCACACAATAACAATGGG + Intergenic
1082682573 11:56194599-56194621 GAATCCTAGAAGAAAACATAGGG + Intergenic
1082911295 11:58377906-58377928 GACTCCAATACAATAATATTTGG + Intergenic
1085592995 11:77781573-77781595 AACTCTTAGACAATAATAAATGG - Intronic
1085813005 11:79702828-79702850 GACTCCCACACAATAACAGTGGG + Intergenic
1086388021 11:86329597-86329619 AAGGCCTAGACAATACCATAAGG - Intronic
1086415346 11:86583857-86583879 AACTCCTAGAAGAAAACATAGGG + Intronic
1086524368 11:87708004-87708026 GACTCCAATACAATAACAGCTGG - Intergenic
1086731316 11:90253037-90253059 AACTCCTAGAAGAAAACATAGGG - Intergenic
1086815948 11:91370914-91370936 AACTTCTAGAAAAAAACATAAGG - Intergenic
1086967572 11:93045417-93045439 GACTCCCACACAATAACAATGGG + Intergenic
1087616447 11:100491214-100491236 GACTCCCATACAATAATATTGGG + Intergenic
1087718766 11:101638481-101638503 GACTCCTACACAATAATAGTGGG + Intronic
1087719084 11:101641416-101641438 GACTCCCACACAATAATAAAGGG + Intronic
1087913166 11:103776837-103776859 AACTCCTAGAGAAAAACATAGGG - Intergenic
1088289945 11:108225238-108225260 GATTCCTAGATAAAACCATAAGG + Intronic
1089040758 11:115447155-115447177 AATACCTAGACAAGAACATATGG + Intronic
1090545234 11:127758273-127758295 GACTCCCACACAATAACAGTGGG - Intergenic
1090689114 11:129158591-129158613 GACTCCCACACAATAACAGTGGG + Intronic
1091213269 11:133882878-133882900 GACTCCTACACAATAATAGTTGG - Intergenic
1091529072 12:1337157-1337179 GACTCCCACACAATAACAGTGGG - Intronic
1091958209 12:4666484-4666506 AACTCTTAGACAAAAACAAAAGG - Intronic
1093060464 12:14597334-14597356 GACTCCCACACAATAATATTGGG - Intergenic
1093522750 12:20069309-20069331 GACTCCCACACAATAACAGTGGG + Intergenic
1093944690 12:25094183-25094205 AACTCCTAGAAGAAAACATAAGG - Intronic
1094168669 12:27468119-27468141 GGCCCCCAGACAATAAGATAAGG + Intronic
1094605165 12:31943481-31943503 AACTAATATACAATAACATAAGG - Intergenic
1094656765 12:32427673-32427695 GACTCCTACACAATAATAGTGGG - Intronic
1094758101 12:33495109-33495131 GACTCCTACACAATAATAGTGGG + Intergenic
1094862083 12:34478823-34478845 GACTCCTACAAAATAATAAAGGG + Intergenic
1095130346 12:38534684-38534706 GACTCCTACACAATAATAATGGG + Intergenic
1095217509 12:39567242-39567264 GACTCCTGCACAATAATATTGGG - Intronic
1095488761 12:42710710-42710732 GACTCCCAGACAATAAGAGTGGG + Intergenic
1095862389 12:46932145-46932167 AACTCCTAGGACATAACATAGGG + Intergenic
1097520946 12:60670401-60670423 GACTCCCACACAATAATATTGGG - Intergenic
1097699305 12:62803589-62803611 AACTCCTAGAAAAAAACATGGGG + Intronic
1097831270 12:64226499-64226521 AACTCCTAGAAAAAAATATAAGG - Intergenic
1098464187 12:70767545-70767567 GACTCCTACACAATAATAATGGG + Intronic
1098780410 12:74678920-74678942 GACTCCCAGACAATAATAATGGG + Intergenic
1098799211 12:74932131-74932153 AACTCCTAGAATAAAACATAGGG - Intergenic
1099314507 12:81067107-81067129 GACTCCCACACAATAACAATGGG + Intronic
1099489835 12:83274876-83274898 GACTCCCACACAATAATAGAGGG - Intergenic
1099542694 12:83933060-83933082 GACTCCTAGAAGAAAACATAGGG + Intergenic
1099550794 12:84041366-84041388 GACTCCTACACAATAATAGTGGG - Intergenic
1099931422 12:89079779-89079801 AACTCCTAGAATAGAACATAGGG - Intergenic
1100907558 12:99319281-99319303 GACTCCTACACAATAATAATGGG - Intronic
1101487746 12:105182863-105182885 GACTCCCACACAATAATATTGGG - Intronic
1102140073 12:110607435-110607457 AACTCCTAGAAGAAAACATAAGG + Intergenic
1103255189 12:119536026-119536048 GACTCCTACACAATAATAATGGG - Intronic
1104238622 12:126964270-126964292 AACTCCTAGAAGAAAACATACGG + Intergenic
1104246519 12:127047546-127047568 GAATCCATGACTATAACATATGG - Intergenic
1104825500 12:131705760-131705782 GACTCCAATACAATAACAGCTGG + Intergenic
1105286051 13:19005326-19005348 GACTCCCACACAATAACAGTGGG - Intergenic
1105478561 13:20751270-20751292 AACTTCTAGACAAAAACATAAGG - Intronic
1106063547 13:26320447-26320469 AACTCTTAGAAGATAACATAGGG + Intronic
1106112221 13:26787000-26787022 GACTTTTAGACAAGAACAGATGG + Intergenic
1106326083 13:28691700-28691722 GACTCCTACACAATAATAGTGGG - Intergenic
1106445527 13:29827294-29827316 GACTCCCACACAATAACAATGGG - Intronic
1108170569 13:47737299-47737321 GACTCCCAGACAATAATAATGGG + Intergenic
1108255687 13:48608568-48608590 GACACCTAGACAATAATAGCTGG - Intergenic
1108445639 13:50506647-50506669 GACTCCTACACAATAATAATGGG - Intronic
1108865745 13:54920250-54920272 GACTCCCAGACAATAATACTGGG + Intergenic
1109607798 13:64720442-64720464 GACTCCCACACAATAATATTGGG + Intergenic
1109666821 13:65551053-65551075 GACTCCCACACAATAATATCTGG - Intergenic
1109693267 13:65921031-65921053 AACTCCTAGAAGATAACATCAGG + Intergenic
1109806879 13:67454837-67454859 GACTCCTACACAATAATATTGGG + Intergenic
1109859949 13:68184397-68184419 GACTCCTGAGCAATAACAAATGG - Intergenic
1110398614 13:75063653-75063675 GACTCCTATACAATGAAAAAAGG - Intergenic
1111071507 13:83173678-83173700 GACTCCCAGACAATAATAATGGG + Intergenic
1112161223 13:96870230-96870252 AACTCTTAGAAAAAAACATAGGG - Intergenic
1112411762 13:99170584-99170606 GACTCCCACACAATAATATTGGG - Intergenic
1112913554 13:104520017-104520039 GACTCCGACACAATAATATTGGG - Intergenic
1112920358 13:104604570-104604592 CACTCCTAGACACTAGCATGGGG + Intergenic
1113211578 13:107988729-107988751 GACTCCCACACAATAATATTGGG - Intergenic
1113237287 13:108293020-108293042 GACTCTTAGAAGAAAACATATGG - Intronic
1114068018 14:19082463-19082485 AACTCCTAGAAGAGAACATAGGG + Intergenic
1114094245 14:19317558-19317580 AACTCCTAGAAGAGAACATAGGG - Intergenic
1114175372 14:20314502-20314524 AACTCCCAGAAGATAACATAGGG + Intronic
1114572980 14:23687921-23687943 GACTCCCACACAATAACAATGGG - Intergenic
1114785602 14:25594116-25594138 GACTCCTACACAATAATAGTGGG - Intergenic
1114800267 14:25766492-25766514 AACTACCAGAGAATAACATAAGG - Intergenic
1114956080 14:27821243-27821265 GACTCCTACACAATAATAGTGGG - Intergenic
1116177677 14:41493635-41493657 GACTCCTACACAATAATAGTGGG + Intergenic
1116227366 14:42169654-42169676 GACTCCCACACAATAACAGTGGG - Intergenic
1116320572 14:43456607-43456629 GACTCCCACACAATAACAGTAGG + Intergenic
1116384280 14:44311429-44311451 GACTCCTACACAATAATAATGGG + Intergenic
1116747373 14:48837763-48837785 CTCTACTAGACAAAAACATATGG + Intergenic
1117637486 14:57760129-57760151 AACTCCTAGACGATAACAACTGG - Intronic
1117829500 14:59735768-59735790 GACTCCCACACAATAACAGTGGG + Intronic
1117856547 14:60040371-60040393 GACTCCTACACAATAATAATGGG - Intronic
1118415844 14:65535890-65535912 GACTCCCACACAATAACAGTGGG - Intronic
1118448562 14:65875293-65875315 GACTCCCACACAATAACAGTGGG - Intergenic
1118546154 14:66891535-66891557 AACTCTTAGAAAAAAACATAGGG + Intronic
1118815042 14:69305865-69305887 AACTCCTAGAAGAAAACATAGGG - Intronic
1118877988 14:69800798-69800820 GACTCCCACACAATAACAGAGGG + Intergenic
1120723597 14:87914201-87914223 GACTCCTACACAATAATAGTGGG - Intronic
1121464669 14:94107483-94107505 AACTCCTAGAAGAAAACATAGGG - Intronic
1121759389 14:96431869-96431891 GACTCCTACACAATAATAATGGG - Intronic
1123424778 15:20161622-20161644 AACTCCTAGAAGAAAACATAGGG - Intergenic
1123534002 15:21168153-21168175 AACTCCTAGAAGAAAACATAGGG - Intergenic
1124666978 15:31600990-31601012 GACTCCCACACAATAACAGTGGG + Intronic
1124935732 15:34168469-34168491 GACTCCCACACAATAACAATGGG + Intronic
1125288766 15:38122256-38122278 GACTCCTACACAATAATAATGGG + Intergenic
1126322887 15:47444752-47444774 CACTCCTAGACACTACCATGGGG - Intronic
1126542263 15:49836835-49836857 GACTCCCACACAATAACAATGGG - Intergenic
1126549738 15:49914369-49914391 AACTACTAGAAGATAACATAGGG + Intronic
1127778753 15:62292493-62292515 GACTCCTACACAATAATACTGGG - Intergenic
1130452853 15:84074609-84074631 GACTCCCAGACAATAATAACTGG + Intergenic
1133560541 16:6946268-6946290 TAGCCATAGACAATAACATATGG + Intronic
1134381388 16:13730032-13730054 AACTCCTAGAAAAAAGCATAAGG - Intergenic
1134743358 16:16568224-16568246 AACTCCTAGAAGAAAACATAGGG + Intergenic
1134924200 16:18144238-18144260 AACTCCTAGAAGAAAACATAGGG - Intergenic
1135167645 16:20154855-20154877 AACTCCTAGAAGAAAACATAGGG - Intergenic
1135171315 16:20186545-20186567 GACTTCTTCACAATAAAATAAGG + Intergenic
1135609258 16:23851185-23851207 AACTGCTAGAGAAAAACATAAGG - Intronic
1136017539 16:27412035-27412057 AACTCCTAGAAGAAAACATATGG - Intronic
1136689070 16:32015423-32015445 AACTCCTAGAAAAAAAAATAAGG + Intergenic
1136860081 16:33694122-33694144 AACTCCTAGAAGAAAACATAGGG + Intergenic
1137360595 16:47811585-47811607 GACTCCCACACAATAATAAAGGG - Intergenic
1137461226 16:48665938-48665960 GACTCCTACACAATAATAATGGG - Intergenic
1138033376 16:53578939-53578961 GACTCCTAGAGAGTGACAGATGG - Intergenic
1138702265 16:58876731-58876753 GACTCCTACACAATAATAATGGG - Intergenic
1139370310 16:66463728-66463750 AACTCTTAGATAAAAACATAGGG - Intronic
1140165502 16:72546067-72546089 GACTCCCACACAATAATATTGGG + Intergenic
1140618028 16:76691046-76691068 AACTCCTAGAAGAAAACATAAGG + Intergenic
1203121584 16_KI270728v1_random:1542280-1542302 AACTCCTAGAAGAAAACATAGGG + Intergenic
1144393732 17:14821979-14822001 GACTCCTAGAAGAAAACATAGGG - Intergenic
1144414776 17:15035587-15035609 GACCCACAGACAATATCATAAGG - Intergenic
1146215559 17:30976561-30976583 GACTCCAATACAATAACAGCTGG - Intronic
1147056622 17:37839833-37839855 GACTCTTAGACAGTCACATGGGG - Intergenic
1149281023 17:55106067-55106089 GACTCCCACACAATAACAGTGGG - Intronic
1149377697 17:56062342-56062364 GACTCCTACACAATAATAGTGGG - Intergenic
1149405265 17:56342898-56342920 GACTCCCACACAATAACAGTGGG - Intronic
1149643767 17:58223377-58223399 AACTTCTAGACAGAAACATAGGG + Intronic
1150014882 17:61544157-61544179 AACTCCTAGAAGATAATATAGGG - Intergenic
1150039244 17:61841109-61841131 GACTACTAGAAGAAAACATAGGG + Intronic
1150190224 17:63230875-63230897 GACTCCTACACAATAATAGTGGG - Intronic
1151182638 17:72340665-72340687 GACTCTTAGAGACTGACATACGG + Intergenic
1203159766 17_GL000205v2_random:38623-38645 AACTCCTACACAAAAATATAAGG + Intergenic
1153119331 18:1702187-1702209 GACTCCCAGACAATAAAAGTGGG + Intergenic
1153418140 18:4873083-4873105 GACTCTTAGAAGAAAACATATGG + Intergenic
1153729444 18:7994356-7994378 GACTCCGTTACAATAACAGATGG + Intronic
1154288345 18:13082216-13082238 GACTCCCAGACAATAATAATTGG - Intronic
1154364295 18:13692280-13692302 GACTCCTACACAATAATAATGGG + Intronic
1154517363 18:15187436-15187458 GACTCCCAGACAATAATAGTGGG - Intergenic
1155253791 18:23976974-23976996 GACTCCTACACAATAATAGTGGG - Intergenic
1155271072 18:24141702-24141724 GACTCCTAAAAAATCACCTAAGG - Intronic
1155350782 18:24903636-24903658 GACTCCTACACAATAACAATGGG + Intergenic
1155761035 18:29567364-29567386 CACTCCTATTCATTAACATATGG + Intergenic
1156896607 18:42253890-42253912 GACTCCTACACAATAACAGTGGG - Intergenic
1159082369 18:63749978-63750000 GACTTCTAGAAGATAACAAAGGG - Intergenic
1159581594 18:70239249-70239271 GACTCCCACACAATAACAGTGGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1163056396 19:14722698-14722720 GACTCTTAGAAGAAAACATAGGG - Intronic
1163264747 19:16213200-16213222 GACTCCCACACAATAACAGTGGG - Intronic
1164553098 19:29228169-29228191 GACTCCTACACAATAATAATGGG + Intergenic
1165003521 19:32785572-32785594 GACTCCCACACAATAATAAATGG - Intronic
1165047725 19:33118952-33118974 GACTCAGAGACATTAACATGGGG + Intronic
1165270583 19:34703993-34704015 GACTCCCACACAATAACAATGGG - Intergenic
1166437735 19:42783466-42783488 GACTCTTAGAAGAAAACATAAGG + Intronic
1166456684 19:42947263-42947285 GACTCTTAGAAGAAAACATAAGG + Intronic
1166466640 19:43038128-43038150 GACTCTTAGAAGAAAACATAAGG + Intronic
1166493548 19:43281185-43281207 GACTCTTAGAAGAAAACATAAGG + Intergenic
1166616272 19:44250280-44250302 GACTCCCACACAATAACAGTGGG + Intronic
1167977800 19:53245172-53245194 AACTCCTAGAAGAAAACATAGGG + Intronic
924975302 2:168146-168168 AACTTCTAGAAGATAACATAAGG + Intergenic
925803739 2:7628130-7628152 GGCTACAAGTCAATAACATATGG - Intergenic
926139302 2:10358971-10358993 CACTCCTAGACACTACCATGGGG + Intronic
926508837 2:13747696-13747718 GACTCCTACACAATAACAGTGGG + Intergenic
927806757 2:26154564-26154586 AACTCCTAGAAGAAAACATAGGG + Intergenic
928715272 2:34053196-34053218 GACACCAATACAATAACAGATGG - Intergenic
929091300 2:38219901-38219923 AACTACTAGAAAAAAACATAGGG + Intergenic
929255872 2:39811302-39811324 GACTCCTACACAATAATAGTGGG - Intergenic
929257486 2:39828587-39828609 GACTCCCACACAATAACAGTGGG - Intergenic
929422691 2:41809925-41809947 AACTCCTAGAAGAAAACATAGGG + Intergenic
929814011 2:45216725-45216747 AACTCCTAGAAGAAAACATAAGG + Intergenic
930143383 2:47976060-47976082 GACTCCTACACAATAATAATGGG + Intergenic
930175809 2:48300603-48300625 GACTCCCACACAATAACAGTGGG - Intergenic
930342999 2:50141351-50141373 AACTACTAGAAAAAAACATAGGG + Intronic
930859754 2:56059011-56059033 AACTACTAGACAAAAGCATAGGG - Intergenic
931204416 2:60133806-60133828 GACTCCCACACAATAATATTGGG - Intergenic
932642489 2:73462987-73463009 GACTCCCACACAATAACAATGGG + Intronic
933277233 2:80296957-80296979 AAATCCCTGACAATAACATATGG + Intronic
933507663 2:83199306-83199328 GACTCCTACACAATAATAATGGG + Intergenic
933618413 2:84509179-84509201 GACTCCCACACAATAATAAAGGG - Intergenic
934314478 2:91903864-91903886 GACTCCCACACAATAATAAAGGG + Intergenic
934458438 2:94195237-94195259 AACTCCTAGAAGAAAACATAGGG + Intergenic
934923332 2:98363903-98363925 GACTCCCACACAATAACAGCGGG - Intronic
934998894 2:98991581-98991603 GACTCCTACACAATAATAATGGG + Intergenic
936085627 2:109466673-109466695 AACTCCTAGAAGATAACATATGG - Intronic
936438255 2:112527424-112527446 GACTCCTACACAATAATAGTGGG - Intronic
936488131 2:112944866-112944888 AACTCCTAGAAGAAAACATAGGG - Intergenic
936654691 2:114471409-114471431 GATTCCTAGAGAATCAAATAGGG + Intronic
936940686 2:117881385-117881407 GACTACTAGAAGAAAACATAGGG - Intergenic
938245571 2:129774912-129774934 GACTACTAGAAGAAAACATAGGG - Intergenic
938975297 2:136471226-136471248 GACTCCTACACAATAATAATGGG + Intergenic
939013995 2:136879996-136880018 GACTCCTACACAATAATAATGGG + Intronic
940234636 2:151496639-151496661 GCCTCCTAAACAATCACATGAGG + Intronic
940234747 2:151497974-151497996 GCCTCCTAAACAATCACATGAGG + Intronic
940439586 2:153698622-153698644 GACTCCCAAACAATAACAGTGGG + Intergenic
940593756 2:155764721-155764743 GACTCCCACACAATAACAGTGGG - Intergenic
940708140 2:157129180-157129202 GACTCCCACACAATAACAGTAGG + Intergenic
940762991 2:157758584-157758606 GACTCCAACACAATAACAGTTGG + Intronic
940954272 2:159711413-159711435 GTCCCCAAGACAATAAAATAAGG + Intergenic
941075361 2:161001113-161001135 GACTCCCAGACAATAATAATGGG - Intergenic
941076662 2:161012820-161012842 GACTCCCACACAATAACAGTGGG + Intergenic
941136108 2:161720489-161720511 GACTCCCACACAATAACAGTGGG - Intronic
942336584 2:174894008-174894030 AACTCCTAGAAGAAAACATAGGG + Intronic
942622572 2:177863223-177863245 AATTCCTAGAGGATAACATAGGG + Intronic
942836250 2:180302019-180302041 GACTCCCAGACAATAATAATGGG - Intergenic
943372387 2:187030829-187030851 AACTCCTAGAAGAAAACATAGGG + Intergenic
943409023 2:187522303-187522325 AACTTCTAGACAAAAGCATAGGG - Intronic
944008280 2:194939065-194939087 GACTCCTACACAATAATAGTGGG - Intergenic
944033651 2:195267325-195267347 GACTCCTACACAATAATAATGGG - Intergenic
944163596 2:196692927-196692949 GACTCCCACACAATAACAGTGGG - Intronic
944291339 2:198009282-198009304 AACTCCTAGAAAGAAACATAGGG - Intronic
944374990 2:199030972-199030994 GACTCCCACACAATAATAAAGGG + Intergenic
944520766 2:200564672-200564694 GACTCCCACACAATAATAAAGGG - Intronic
944623389 2:201542949-201542971 AACTCCTAGAAGAAAACATAGGG - Intronic
944629506 2:201609222-201609244 GACTCCAATACAATAATATCTGG + Intronic
944751031 2:202709745-202709767 AACTCCTAGAAATAAACATAGGG - Intronic
944812214 2:203338683-203338705 CACTCCTAGAAGAAAACATAGGG + Intronic
945410751 2:209503506-209503528 AACTCCTAGAAGAAAACATAGGG - Intronic
946773502 2:223113281-223113303 TACTTCTAGCCAATAAAATATGG - Intronic
947939890 2:234043737-234043759 AACTCCTAGAAGAAAACATATGG + Intergenic
948328615 2:237147747-237147769 AACTCTTAGAGAAAAACATAGGG - Intergenic
1169157277 20:3342214-3342236 GACCCTGAGACAAGAACATAAGG - Intronic
1169513255 20:6288610-6288632 AACTCTTAGAAAAAAACATAGGG + Intergenic
1170179029 20:13508136-13508158 AACTCCTAGAAGAAAACATAGGG + Intronic
1170238697 20:14137674-14137696 AACTCCTAGAAGATAACATAGGG + Intronic
1170250241 20:14273024-14273046 GACTCCTACACAATAATAATGGG + Intronic
1170294489 20:14808968-14808990 GACTCCTACACAATAATAGTGGG + Intronic
1170730240 20:18967986-18968008 GACTCCTACACAATAATAGTTGG + Intergenic
1170977335 20:21177678-21177700 AACTCCTAGAAGAAAACATAGGG - Intronic
1171039682 20:21749283-21749305 GACTCCCACACAATAATAAAGGG - Intergenic
1171054219 20:21890048-21890070 GACTCCCACACAATAATAAAGGG + Intergenic
1171281846 20:23907413-23907435 GACTCCCAAACAATAACAGTGGG - Intergenic
1171397622 20:24848019-24848041 GACTCCTACACAATAATAGTGGG - Intergenic
1172724850 20:37031089-37031111 AACTCTTAGACGAAAACATAGGG + Intronic
1173203954 20:40977081-40977103 GACTCCAATACAATAACAGCTGG - Intergenic
1176344203 21:5726662-5726684 GACTCCCACACAATAACACTGGG - Intergenic
1176351017 21:5847246-5847268 GACTCCCACACAATAACACTGGG - Intergenic
1176500624 21:7597794-7597816 GACTCCCACACAATAACACTGGG + Intergenic
1176538524 21:8124731-8124753 GACTCCCACACAATAACACTGGG - Intergenic
1177463636 21:21445444-21445466 GACTCCCACACAATAACAGTGGG - Intronic
1178230951 21:30784042-30784064 AACTCCTAGAATAAAACATAGGG - Intergenic
1178393867 21:32222322-32222344 GACTCCCAAACAATAACAGTGGG + Intergenic
1180486492 22:15805030-15805052 AACTCCTAGAAGAGAACATAGGG + Intergenic
1181357766 22:22311197-22311219 AACTCCTAGAAGAAAACATAGGG - Intergenic
1182157251 22:28086043-28086065 GACTCCCACACAATAATATTGGG + Intronic
1182628315 22:31664570-31664592 TACTCTTAGACGAAAACATAGGG + Intergenic
1182661690 22:31929587-31929609 GACTCATAAAAAATAACAAATGG - Intergenic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1183913830 22:41100424-41100446 TACTCCTAGAAAACAACATTTGG - Intronic
1184438130 22:44492473-44492495 GTCTGCTAGACAAGAACACAAGG - Intergenic
1184809470 22:46820836-46820858 GACTCCCACACAATAACAGTGGG - Intronic
1203243470 22_KI270733v1_random:41086-41108 GACTCCCACACAATAACACTGGG - Intergenic
949212734 3:1525102-1525124 GTCTTCCACACAATAACATAAGG - Intergenic
949222454 3:1652189-1652211 GACTCCCATACAATAACAGTGGG - Intergenic
949359704 3:3218947-3218969 AACTCTTAGACAAAAACATAAGG - Intergenic
949418537 3:3839101-3839123 AACTCCTAGAAGAAAACATAAGG - Intronic
949440404 3:4073869-4073891 GACTCCTACACAATAATAATGGG + Intronic
951184479 3:19696725-19696747 GACTCCTAGAAAAAAATATAGGG + Intergenic
951257400 3:20466113-20466135 AACTCCTGGAATATAACATATGG - Intergenic
951490302 3:23262858-23262880 AACTCCTAGAAGAAAACATATGG - Intronic
951490522 3:23265757-23265779 GACTCCCACACAATAACAATGGG - Intronic
951676189 3:25244916-25244938 GACTCCCACACAATAACAGTGGG - Intronic
951687345 3:25360086-25360108 GACTCCCACACAATAATATTGGG - Intronic
952128161 3:30327619-30327641 AACTCCTAGAAGATAAAATAGGG + Intergenic
952475792 3:33709201-33709223 AACTCCTAGAAGAAAACATAGGG - Intronic
952633443 3:35498154-35498176 GACTGCGAGACAATTACAAAAGG - Intergenic
953254899 3:41280189-41280211 GACTCCTACACAATAATAATGGG + Intronic
953543830 3:43846080-43846102 GACTCCCACACAATAATAGAGGG + Intergenic
953817621 3:46173434-46173456 AACTCCTAGAAGAAAACATAGGG - Intronic
954319704 3:49823577-49823599 AACTCCTAAAAGATAACATAGGG + Intergenic
954475737 3:50743720-50743742 GACTCCTACACAATAATAATGGG + Intronic
954475776 3:50744366-50744388 GTCTCCTAGAAGAAAACATAGGG - Intronic
954522364 3:51240542-51240564 GACTCCTACACAATAATAGAGGG - Intronic
954524130 3:51254478-51254500 GACTCCCACACAATAACAATGGG - Intronic
955464678 3:59224440-59224462 GACTCCCACACAATAATAAAAGG - Intergenic
955831876 3:63013649-63013671 GACTCCCACACAATAACAGTGGG - Intergenic
956355973 3:68392391-68392413 GACTCCCACACAATAATAGAGGG + Intronic
956387926 3:68740746-68740768 AACTCCTAGAAGAAAACATAGGG - Intronic
956397867 3:68845122-68845144 GACTCCCACACAATAACAGCGGG - Intronic
957011007 3:75006485-75006507 GACTCCCACACAATAATAGAGGG - Intergenic
957420564 3:79963873-79963895 AACTCCTAGAAGAAAACATAGGG + Intergenic
957475083 3:80711956-80711978 GACTCCCAGACAATAATAGTGGG + Intergenic
957686107 3:83504366-83504388 GACAACTAGACTATGACATATGG + Intergenic
957696588 3:83647786-83647808 GACTCCCACACAATAATAGAGGG - Intergenic
958458910 3:94369362-94369384 GACTCCCACACAATAATATTGGG - Intergenic
958586502 3:96093752-96093774 GACTCCTACACAATAATAGTGGG + Intergenic
958589020 3:96129943-96129965 GACTACTAGAGGAAAACATAGGG + Intergenic
958694323 3:97508767-97508789 GACTCCCACACAATAATAGAGGG - Intronic
959158868 3:102699236-102699258 GACTCTTAGACAGTCACATATGG - Intergenic
959735233 3:109650427-109650449 GACTCCCACACAATAACAGTGGG + Intergenic
960021167 3:112955341-112955363 GACTGCAAGACAATAACATTAGG - Intronic
960295594 3:115939838-115939860 AACTCCTAGAAGAAAACATAGGG - Intronic
960410420 3:117316647-117316669 GACTACTAAAAAATACCATATGG - Intergenic
960540968 3:118862236-118862258 GACTCCTAGAAGAAAACATTTGG - Intergenic
960642767 3:119843704-119843726 GACTCCCACACAATAACAGTGGG + Intronic
960654152 3:119983738-119983760 GACTCCTACACAATAATAATGGG + Intronic
962033427 3:131625334-131625356 GACTTCAAGCCAATAAAATATGG - Intronic
962555564 3:136547814-136547836 GACTCTTAGAAGAAAACATAGGG - Intronic
962854658 3:139333149-139333171 GACTCCCACACAATAATATTGGG + Intronic
963824837 3:149941785-149941807 AACTCCTAGAAAAAAATATAGGG - Intronic
963848749 3:150186029-150186051 AACTCCTAGAAGAAAACATAGGG + Intergenic
963848944 3:150188745-150188767 GCCTCCTAGAAGATAACATAGGG - Intergenic
963942903 3:151113010-151113032 GTCTCCTCGACAAGAAGATAAGG - Intronic
963980504 3:151531219-151531241 GACTCCCACACAATAACAGTGGG + Intergenic
964325820 3:155544417-155544439 GACTCCCACACATTAACATTGGG + Intronic
964428585 3:156579738-156579760 GTCTCATAGGCAAAAACATAAGG - Intergenic
964431207 3:156607898-156607920 AACTCCTAGAAGAAAACATAAGG - Intergenic
965113523 3:164457932-164457954 AACTCTTAGGTAATAACATAGGG - Intergenic
965325006 3:167292085-167292107 GACTCCTATACAATAATAGTGGG + Intronic
965616103 3:170594011-170594033 GCCTCCTCTACAATAACACAGGG - Intronic
965818706 3:172663572-172663594 GACTCCCAAACAATAATATTGGG - Intronic
965886174 3:173449674-173449696 GACTCCCACACAATAACAATGGG - Intronic
966014899 3:175130442-175130464 AACTCCTAGAAGAAAACATAGGG - Intronic
966582919 3:181589003-181589025 GACTCCCACACAATAATATTGGG - Intergenic
967513830 3:190342852-190342874 AACTCCTGGAAAAAAACATAGGG + Intronic
968108451 3:196021293-196021315 AACTTCTAGAAGATAACATAAGG + Intergenic
969082623 4:4631118-4631140 GACTGTGAGACACTAACATAAGG - Intergenic
969200058 4:5596099-5596121 GACTCCCACACAATAACAATGGG + Intronic
969456672 4:7304192-7304214 GACCCCCAGGCAAGAACATAAGG - Intronic
969921943 4:10548602-10548624 AACTCCTAGAAGAAAACATAGGG - Intronic
970165188 4:13229218-13229240 GACTCCCACACAATAACAGTGGG + Intergenic
970304924 4:14721257-14721279 GACTCCCACACAATAACAGTGGG + Intergenic
970684206 4:18547380-18547402 AACTCCTAGAAGAAAACATAGGG - Intergenic
970880966 4:20930402-20930424 AACTCCTAGAGAAGAACATAGGG + Intronic
971090634 4:23340900-23340922 AACTCCTAGAAGATAACAAAAGG + Intergenic
971429805 4:26554121-26554143 GACTCCCACACAATAACATTGGG - Intergenic
971551254 4:27959143-27959165 GACTACTAGACAGTAAAAGACGG + Intergenic
971605085 4:28648992-28649014 GACTCCTACACAATAATAGTGGG - Intergenic
971624069 4:28896107-28896129 GACTCCCACACAATAACAGTGGG + Intergenic
972352074 4:38245149-38245171 GTTTCTTAAACAATAACATAGGG + Intergenic
972668544 4:41191663-41191685 GACTCCCAGAAGAGAACATAAGG + Intronic
973228783 4:47818387-47818409 AACTACTAGACAATAAAGTATGG + Intronic
973341604 4:49011087-49011109 GACTCCTACACAATAATAATAGG - Intronic
973584908 4:52380093-52380115 GACTCCCACACAATAATATTGGG + Intergenic
973732465 4:53835874-53835896 GACTCCCACACAATAACAATGGG + Intronic
973761133 4:54116903-54116925 AACTCCTAGAAGAAAACATAGGG - Intronic
974023910 4:56715143-56715165 GACTCCCACACAATAACAATGGG + Intergenic
974155398 4:58065235-58065257 GACTCCCATACAATAACAGTGGG + Intergenic
974155933 4:58072590-58072612 TACTCCTAGACAATAGAATATGG - Intergenic
974567139 4:63592132-63592154 GACTCCCAGACAATAATAATGGG + Intergenic
974793257 4:66716446-66716468 GACTCCTACACAATAATAGTGGG + Intergenic
974926622 4:68306923-68306945 AACTCCTAGAAGAAAACATAAGG - Intergenic
974937238 4:68422707-68422729 GACTCCCACACAATAATAAAGGG + Intergenic
975449527 4:74507854-74507876 GACTCCCACACAATAATATTGGG + Intergenic
975454086 4:74568835-74568857 AACTCCTAGAAGAAAACATAGGG + Intergenic
975504174 4:75119976-75119998 GACTCCAATGCAATAACAGATGG + Intergenic
975532795 4:75418531-75418553 GACTCCTACACAATAATAGTGGG - Intergenic
975726688 4:77299097-77299119 GACTCCTACACAATAATAATGGG - Intronic
975955840 4:79837311-79837333 AACTCTTAGAAAAAAACATAGGG - Intergenic
976240826 4:82954896-82954918 AACTCCTAGAAGATAACATTTGG + Intronic
976336097 4:83888934-83888956 AACTCCTAGAAGAAAACATAGGG - Intergenic
976585613 4:86793384-86793406 GACTCCTACACAATAATAATGGG + Intronic
976760300 4:88541472-88541494 GACTCCCACACAATAACAATGGG + Intronic
976819555 4:89189965-89189987 GACTCCCAGACAATAATAGTAGG - Intergenic
977029268 4:91861936-91861958 GACTCCTACACAATAATAATGGG - Intergenic
977154736 4:93557618-93557640 GACTCCCACACAATAATATTGGG + Intronic
977439222 4:97040926-97040948 AACTCCTAGAAGATTACATAGGG + Intergenic
977511435 4:97967388-97967410 GACTCCTACACAATAATAATGGG + Intronic
977608645 4:99009977-99009999 AACTCCTAGATGAAAACATAAGG - Intronic
977631228 4:99245828-99245850 GACTCCCACACAATAATATTGGG - Intergenic
977680749 4:99796248-99796270 GACTCCCAGACAATAATAATGGG - Intergenic
977737738 4:100437503-100437525 AACTCCTAGAAGACAACATAGGG - Intronic
978212952 4:106160168-106160190 GACTCTTAGAAGAAAACATAGGG + Intronic
979160253 4:117450577-117450599 GACTCCTACACAATAACAGTGGG + Intergenic
979968745 4:127108365-127108387 GACTCCTACACAATAATAATGGG + Intergenic
980257424 4:130400453-130400475 GACTCCCAAACAATAATATTGGG - Intergenic
980437060 4:132790883-132790905 AACTCTTAGACAAAAACATTGGG + Intergenic
980554647 4:134387283-134387305 CACTCCTAGACACTACCATGGGG + Intergenic
980813749 4:137916639-137916661 GACTCCCACACAATAACAATGGG + Intergenic
981512126 4:145568940-145568962 GACTCCCACACAAAAACAGAGGG + Intergenic
981540938 4:145845699-145845721 GAATACAAAACAATAACATATGG + Intronic
981665041 4:147214947-147214969 GACTCCTACACAATAATAGTGGG - Intergenic
981750114 4:148085034-148085056 GACTCCCACACAATAATATTGGG + Intronic
981859592 4:149339174-149339196 GACTCTTACACAATAATATTGGG - Intergenic
982453311 4:155577716-155577738 GGCTTCTAAACAATAAAATATGG - Intergenic
982613326 4:157606349-157606371 AACTCCTAGAAGAAAACATAGGG + Intergenic
983227059 4:165095155-165095177 GACTCCTACACTATAAGATGGGG + Intronic
983298775 4:165899832-165899854 GACTCCTACACAATGACAGTGGG - Intronic
983402901 4:167287874-167287896 GACTCCCAGACAATAATAGTGGG - Intergenic
984008809 4:174346213-174346235 GACTCCCACACAATAACAGTGGG - Intergenic
984224651 4:177019739-177019761 GACTCCTATACAATAATAATGGG + Intergenic
984354434 4:178639515-178639537 GACTCCTACACAATAATACTGGG + Intergenic
984728534 4:183044331-183044353 AACTACTAGAAAATAACATAAGG + Intergenic
985176890 4:187211708-187211730 GACTCCTTGACAATGTCCTATGG - Intergenic
985388700 4:189471871-189471893 AACTCCTAGAAGAAAACATAGGG - Intergenic
985428242 4:189851743-189851765 AACTACTAGAAAAAAACATAGGG - Intergenic
985470382 5:38890-38912 AACTCCTAGAAGATAACATAAGG + Intergenic
986090790 5:4502511-4502533 AACTCCTAGAAAAAAATATAGGG - Intergenic
986364180 5:7013407-7013429 AACTCCTAGAAGAAAACATAGGG - Intergenic
986879838 5:12156028-12156050 GACTCCCACACAATAACAGTGGG + Intergenic
988157463 5:27473520-27473542 GACTCCTTGAGAAAAACAGAAGG + Intergenic
988416315 5:30950502-30950524 GACTCCTACACAATAATAGTGGG + Intergenic
988719452 5:33861558-33861580 GACTCCCACACGATAACATTGGG + Intronic
989787525 5:45348903-45348925 GACTCCCACACAATAATAAAGGG + Intronic
989977046 5:50599722-50599744 GACTCCCACACAATAATAAAGGG - Intergenic
990071514 5:51788760-51788782 GACTCCTACACAATAATAATGGG - Intergenic
990330093 5:54717072-54717094 GACTACTAGAATAAAACATAGGG + Intergenic
990838736 5:60051071-60051093 GACTCCCACACAATAATATTGGG + Intronic
991310384 5:65234174-65234196 GACTACTAGAAGAAAACATAAGG + Intronic
991387754 5:66108464-66108486 GACTCCTACACAATAATAATGGG + Intergenic
991388161 5:66113245-66113267 TAGTCCTAGAAAAAAACATAGGG + Intergenic
991508289 5:67349021-67349043 AACTCCTAGATGAGAACATAGGG + Intergenic
991577966 5:68124578-68124600 GACTCCTACACAATAATAGTGGG + Intergenic
992180373 5:74190732-74190754 AACTCCTAGAAGGTAACATAAGG - Intergenic
992288176 5:75256829-75256851 GACTCCCACACAATAACAGTGGG + Intergenic
992316717 5:75564005-75564027 GACTCCCACACAATAACAGTGGG - Intronic
992495097 5:77284420-77284442 AACTCCTAGAAGATAGCATAGGG - Intronic
992832601 5:80609000-80609022 TGCTTCTGGACAATAACATATGG - Intergenic
993303895 5:86250568-86250590 AACTCCTAGAAAAAAAAATAGGG + Intergenic
993328059 5:86566353-86566375 TACTCTTAAACAATACCATAGGG + Intergenic
993528057 5:88991035-88991057 GACTCCTACACAATAATAATGGG - Intergenic
993757383 5:91748817-91748839 GACTCCCACACAATAACAGTGGG - Intergenic
993846518 5:92951181-92951203 GACTCCAATACAATAATATTTGG - Intergenic
994224598 5:97237877-97237899 GACTCCCACACAATAATATTGGG - Intergenic
994280858 5:97900764-97900786 GACTCCCACACAATAATAAAGGG - Intergenic
994346575 5:98694666-98694688 GACTCCAACACAATAACAGTGGG - Intergenic
994390246 5:99183686-99183708 GACTCCCACACAATAACAATGGG + Intergenic
994574084 5:101554092-101554114 GACTCCTACACAATAATAATGGG + Intergenic
994657705 5:102614268-102614290 GACTCCTACACAATAATAGTGGG - Intergenic
995593812 5:113727848-113727870 GACTCCTACACAATAATAGTGGG - Intergenic
995685097 5:114764208-114764230 GACTCCCACACAATAATATTGGG - Intergenic
995812599 5:116124680-116124702 GACTCCCATACAATAACAATGGG - Intronic
995840027 5:116435316-116435338 AACTCCTAGAAGAAAACATAGGG - Intergenic
995896239 5:117014202-117014224 AACTCCTAGAAAAAAACATAAGG - Intergenic
996169665 5:120273587-120273609 GACTCCTACACAATAATAGTGGG + Intergenic
996181904 5:120429998-120430020 GACTCCTACACAATAATAGTGGG - Intergenic
996452343 5:123639777-123639799 GACACCTAGACCATAACAGAAGG - Intergenic
996829993 5:127729393-127729415 GACTCCTACACAATAATAGTGGG + Intergenic
997190128 5:131924919-131924941 AACTCCTAGAAGAAAACATAGGG - Intronic
997217595 5:132127022-132127044 GACTCCCACACAATAAAAAAGGG - Intergenic
997620426 5:135286910-135286932 AACTCCTAGAAGAAAACATAGGG - Intronic
997745012 5:136291672-136291694 GACTCCCACACAATAACAATGGG + Intronic
997776544 5:136613038-136613060 AACTACTAGAAAAAAACATAGGG + Intergenic
998694804 5:144627422-144627444 GACTCCCACACAATAACAATGGG - Intergenic
999224879 5:150013089-150013111 AAGTCCTAGACAATATCATAAGG - Intronic
999421037 5:151443765-151443787 AACTCCTAGAAGAGAACATAGGG - Intronic
999603628 5:153294273-153294295 GACTCCCACACAATAACAATGGG - Intergenic
999604910 5:153304048-153304070 GACTCCCACACAATAACAATGGG - Intergenic
999812826 5:155144107-155144129 GAATCCTAGACAATTAGATTTGG + Intergenic
1000031960 5:157409605-157409627 GACTCCTACACAATAATAGTAGG + Intronic
1000539507 5:162522608-162522630 GACTCCAATACAATAAGATTTGG - Intergenic
1000548321 5:162628251-162628273 GACTCCCACACAATAACAGTGGG + Intergenic
1000582347 5:163049373-163049395 GACTCCTACACAATAATAGTGGG + Intergenic
1000660776 5:163935377-163935399 GACTCCAACACAATAATATTGGG + Intergenic
1001114837 5:168930879-168930901 GCCTCCTAGACAATAACCTGTGG + Intronic
1002218628 5:177660105-177660127 GACTCCCACACAATAACAGTGGG + Intergenic
1002497293 5:179624015-179624037 GACTCCTATACAGTCCCATAGGG - Exonic
1003165636 6:3675818-3675840 GACTCCCACACAATAACAATGGG - Intergenic
1005372192 6:25145231-25145253 AAGTTCTAGACAATAAAATAGGG + Intergenic
1006208356 6:32370786-32370808 AAATCTTAGACAATATCATATGG + Intronic
1008521886 6:52369513-52369535 GACTCCAAGAGAATACCAAAAGG + Intronic
1008726159 6:54422937-54422959 GACTCCTGGACAAAAACATAGGG + Intergenic
1008736790 6:54554579-54554601 GACTCCTACACAATAATACTGGG + Intergenic
1008796121 6:55305131-55305153 AACTCCAAGAAAAAAACATAAGG - Intergenic
1008998101 6:57682016-57682038 GACTCCTACACAATAATAGTGGG + Intergenic
1009186594 6:60581386-60581408 GACTCCTACACAATAATAGTGGG + Intergenic
1009605635 6:65863871-65863893 GACTCCCACACAATAACAATGGG - Intergenic
1009679467 6:66873365-66873387 GACTCCCACACAATAACAGTGGG - Intergenic
1009727613 6:67555976-67555998 GACTCCCACACAATAATATTGGG - Intergenic
1009950041 6:70384946-70384968 AACTCCTAGAAAAAAACATAGGG - Intergenic
1010279766 6:74010781-74010803 GACTCCCACACAATAATATTGGG - Intergenic
1010286347 6:74082643-74082665 GACTCCTACACAATAATAATGGG - Intergenic
1010346868 6:74821266-74821288 AACTACTAGAAAACAACATAGGG + Intergenic
1010485375 6:76405671-76405693 AACTCCTAGAATAAAACATAAGG - Intergenic
1010594836 6:77750650-77750672 GACTCCCACACAATAATATTGGG + Intronic
1010724981 6:79323263-79323285 GACTCCCACACAATAACAATGGG - Intergenic
1010796670 6:80124504-80124526 GACTCCCATACAATAATATTGGG - Intronic
1010821098 6:80416963-80416985 GACTCCTACACAATGACAGCGGG - Intergenic
1010901778 6:81435873-81435895 GACTCCCACACAATAACAATGGG + Intergenic
1010972881 6:82282000-82282022 GACTCCCACACAATAATATTGGG - Intergenic
1011174355 6:84543349-84543371 GACTCCCACACAATAACAGTGGG + Intergenic
1011299641 6:85860905-85860927 GACTCCCACACAATAATATTGGG - Intergenic
1011301213 6:85876510-85876532 GACTCCCACACAATAACAGTGGG - Intergenic
1011330084 6:86194840-86194862 CACTACTAGAAAACAACATAGGG + Intergenic
1011383308 6:86766421-86766443 GCCACCTAGACAATAACCCAAGG + Intergenic
1011730546 6:90258163-90258185 AACTCCTACACAGGAACATAGGG - Intronic
1011760949 6:90564600-90564622 GACTCCCATACAATAATATTGGG + Intronic
1011766514 6:90625636-90625658 GACTCCTACACAATAATAGTGGG + Intergenic
1011944405 6:92882657-92882679 GACTCCCACACAATAATATTGGG + Intergenic
1012262647 6:97105783-97105805 TACTTTTAGACAATGACATAGGG + Intronic
1013332078 6:109113120-109113142 GACTCCCACACAATAACAGTGGG - Intronic
1013393459 6:109711056-109711078 GACTCCCACACAATAATAGAGGG - Intronic
1013467838 6:110433171-110433193 GGCTAATAGACAATTACATAGGG + Intronic
1013717362 6:112977345-112977367 GACTACTAGAAGAAAACATAGGG - Intergenic
1013901651 6:115164273-115164295 GACTCCCACACAATAACAGTGGG - Intergenic
1014113627 6:117648075-117648097 GACTCCTATACAATAATAGTGGG + Intergenic
1014163463 6:118196787-118196809 CACTCCTAGAAGAAAACATATGG - Intronic
1014674365 6:124346445-124346467 GACTCCCACACAATAACAATGGG - Intronic
1014789529 6:125656631-125656653 GACTTCTATACAATAAGGTAAGG + Intergenic
1014854598 6:126383804-126383826 GACTCCTAGACAGTAATACTGGG + Intergenic
1014864261 6:126508066-126508088 GACTCCCACACAATAACAGTGGG + Intergenic
1014967928 6:127780009-127780031 GACTCCCACACAATAATATTGGG - Intronic
1015197498 6:130539525-130539547 GACTCCCACACAATAATATTAGG + Intergenic
1015883019 6:137888979-137889001 GACTCCTACACAATAATAGTGGG - Intergenic
1016138899 6:140583624-140583646 GACTCCAATACAATAACATTTGG + Intergenic
1017307034 6:152930555-152930577 AACTCCTAGAAGAAAACATAAGG + Intergenic
1017621345 6:156302192-156302214 AACTCCTAGAAGATAACATGGGG + Intergenic
1018011377 6:159673129-159673151 GACTCCCACACAATAACAATGGG + Exonic
1020525517 7:9253377-9253399 GACTCCCACACAATAACAGTGGG + Intergenic
1020640654 7:10749604-10749626 GACTCCTACACAATAATAATGGG + Intergenic
1021156605 7:17217722-17217744 GACTCCTACACAATAATAATGGG + Intergenic
1021347422 7:19545873-19545895 GACTCCTACACAATAATAATGGG - Intergenic
1021772167 7:24015630-24015652 AACTCCTAGAAGAAAACATAGGG + Intergenic
1021893363 7:25209673-25209695 AACTCCTAGAAGAGAACATAGGG - Intergenic
1023413202 7:39908473-39908495 GACTACTAGAAGAAAACATAGGG + Intergenic
1023668512 7:42551843-42551865 GACTCCAGGAGAAAAACATAGGG + Intergenic
1024389151 7:48787107-48787129 GACTCCCAGACAAAAACAACAGG - Intergenic
1024389975 7:48797815-48797837 AACTCCTAGAAGAGAACATAGGG - Intergenic
1024390730 7:48809042-48809064 AACTACTAGAGAAAAACATAGGG + Intergenic
1024536986 7:50444309-50444331 GAATCCTAGACAATCATAAAAGG + Intronic
1024666826 7:51555743-51555765 GACTCCCAGACAATAATAATGGG - Intergenic
1024898176 7:54284868-54284890 GACTCCTGGACTTTCACATAGGG - Intergenic
1025547606 7:62197021-62197043 GACTCCCACACAATAACAATGGG - Intergenic
1026389364 7:69884321-69884343 GACTGCTATATAAAAACATAAGG - Intronic
1027301582 7:76842982-76843004 AACTCCTTGAAGATAACATAGGG + Intergenic
1027835987 7:83243303-83243325 AACTCTTAGAAGATAACATAAGG - Intergenic
1027910491 7:84244201-84244223 GACTCCTACACAATAATAGTGGG - Intronic
1027925165 7:84451104-84451126 AACTCCTAGAGGAAAACATAAGG - Intronic
1028415527 7:90576349-90576371 GACTACTAGAAGAAAACATAGGG + Intronic
1028782646 7:94755226-94755248 GACTCCCACACAATAACAGTGGG - Intergenic
1028992013 7:97059020-97059042 GACTCCCACACAATAATAGAGGG + Intergenic
1029333805 7:99882848-99882870 AACTCCTAGAGGAAAACATAAGG - Intronic
1030202716 7:106921329-106921351 GACTCCTACACAATAATAATGGG + Intergenic
1030256120 7:107510428-107510450 GACTCCTACACAATAATAACGGG + Intronic
1030258186 7:107534699-107534721 GACTCCCAGACAGTAACAGTGGG + Intronic
1030340332 7:108372252-108372274 CACACCTAGAAAAAAACATAAGG + Intronic
1030376466 7:108758246-108758268 GACTCCCACACAATAACAGTGGG + Intergenic
1030426291 7:109383035-109383057 GACTCCTACACAATAATAATGGG + Intergenic
1030697208 7:112598917-112598939 AACTCCTAGAAGAAAACATAGGG - Intergenic
1030736288 7:113052679-113052701 GACTCCCACACAATAACAGTGGG - Intergenic
1030851595 7:114493020-114493042 GACTCCTACACAATAATAATGGG - Intronic
1031079546 7:117244993-117245015 AACTCCTAGAACAAAACATAGGG + Intergenic
1031434047 7:121711070-121711092 GACTCCTACACAATAATAATGGG - Intergenic
1031440716 7:121791337-121791359 AACTCCTAGAAGAAAACATAGGG - Intergenic
1031610577 7:123821742-123821764 AACTCCTAGAAGAAAACATAGGG - Intergenic
1031640074 7:124152026-124152048 AACTCCTAGAAGATAACAGAGGG - Intergenic
1031651174 7:124291640-124291662 AACTCCTGGAAAAAAACATAAGG - Intergenic
1031705701 7:124978619-124978641 GACTCCCACACAATAACAACGGG + Intergenic
1031725001 7:125227606-125227628 AACTCCTGGAAAATAGCATAGGG - Intergenic
1032312299 7:130799928-130799950 GACTCCCACACAATAACAATGGG - Intergenic
1032593041 7:133210703-133210725 GACTCCCACACAATAACAATGGG + Intergenic
1032750476 7:134834952-134834974 GCTTCCTAGACATTAACAGATGG + Intronic
1033054808 7:138041113-138041135 GACACCTAGGCAATACCATTCGG + Intronic
1033106847 7:138534825-138534847 GACTCCCAGACAATAATAATGGG - Intronic
1033462404 7:141559215-141559237 AACTCCTAGAAGAAAACATAGGG - Intronic
1033499753 7:141936110-141936132 GGTTCCTTGACAATAATATAAGG + Intronic
1033638201 7:143233079-143233101 AACTACTAGAGAAAAACATAGGG - Intergenic
1033715504 7:143997668-143997690 GAGTCCTAGCCAAAATCATAAGG + Intergenic
1033933148 7:146548956-146548978 AACTCCTAGATGAAAACATATGG - Intronic
1037106758 8:15118379-15118401 GACTCCCAGACAGTAAAAGAAGG + Intronic
1037249331 8:16874897-16874919 GACTCCTATACAATAATAGTGGG - Intergenic
1037291372 8:17352492-17352514 AACTCCTAGAAAAGAACATAAGG + Intronic
1038077560 8:24093815-24093837 AATTCCTAGACAAAAACATAGGG + Intergenic
1038083053 8:24162142-24162164 GACTCCTACACAATAATAGTGGG - Intergenic
1039138334 8:34353803-34353825 GTCTCTTAGACAAACACATATGG + Intergenic
1039210938 8:35214314-35214336 GACTCCTAAACAATAAATCAAGG - Intergenic
1040373492 8:46799840-46799862 GACTCCCACACAATAATAAACGG + Intergenic
1040409089 8:47136705-47136727 AACTGCTAGAAAAAAACATAGGG - Intergenic
1040420395 8:47234497-47234519 GACTCCTAGAATATAACATAGGG + Intergenic
1040553747 8:48460825-48460847 GACTCCCACACAATAACAATGGG - Intergenic
1040736791 8:50517836-50517858 GACTCCCAGACAATAATAGTGGG + Intronic
1041338044 8:56810190-56810212 GACTCCCACACAATAATATTGGG - Intergenic
1041382940 8:57271191-57271213 GACTCCCACACAATAACAATGGG - Intergenic
1041387974 8:57324537-57324559 GACTCCCAGACAATAATAATGGG - Intergenic
1042622469 8:70721908-70721930 GACTCCCACACAATAACAGTGGG - Intronic
1042644059 8:70966730-70966752 GACTCCCACACAATAATATTGGG - Intergenic
1043118121 8:76286190-76286212 GACTCCTACACAATAATAGTGGG - Intergenic
1043160009 8:76834843-76834865 AACTCCTAGAAGATAACATAAGG - Intronic
1043417078 8:80062430-80062452 AAGTCTTAGACAAAAACATAGGG + Intronic
1043726730 8:83620904-83620926 GACTCCTACACAATAATAATGGG - Intergenic
1044054936 8:87556867-87556889 GACTCCCACACAATAACAATGGG - Intronic
1044283014 8:90377956-90377978 GAGTCCCAGACAATAACAGTGGG + Intergenic
1044737241 8:95291591-95291613 AACTCCTAGAAGAAAACATAAGG - Intergenic
1044793755 8:95874669-95874691 GACTCCTACACAATAATAGTGGG + Intergenic
1045164737 8:99590947-99590969 GACTCCCACACAATAACAATGGG - Intronic
1045563598 8:103290878-103290900 AACTCCTAGAAGAAAACATAAGG - Intergenic
1045990932 8:108306877-108306899 GCCTCCTGGAAAATAACATCTGG - Intronic
1046884404 8:119348015-119348037 ATCTCCTGGAAAATAACATAGGG - Intergenic
1048490887 8:134892722-134892744 GTCTCCTAGACTATACCAAAGGG + Intergenic
1048805139 8:138233558-138233580 AACTCCTAGAAGAAAACATAAGG + Intronic
1049128381 8:140812913-140812935 GACTCCTACACAATAATAGTGGG + Intronic
1050200953 9:3145512-3145534 GACTCCTACACAATAGCAGTGGG - Intergenic
1050239650 9:3621941-3621963 GACTCCTACACAATAATAGTGGG - Intergenic
1050322686 9:4469166-4469188 GACTCCTACACAATAATAATGGG + Intergenic
1050329767 9:4533594-4533616 GACTCCTACACAATAATAATGGG + Intronic
1050578366 9:7024238-7024260 GACTCCAATACAATAACAGCTGG - Intronic
1050671781 9:8005978-8006000 GACTCCCACACAATAACAATGGG - Intergenic
1050675267 9:8045219-8045241 GACTCCCACACAATAACAATGGG - Intergenic
1050966235 9:11806754-11806776 GACTTCTATAAAATCACATAAGG + Intergenic
1050982568 9:12038381-12038403 GACTCCTAAACAATAACAGTGGG + Intergenic
1051078585 9:13269997-13270019 GAATCCTATAGAATTACATATGG - Intronic
1051113677 9:13669585-13669607 AACTCCTAGAAGACAACATATGG + Intergenic
1051280312 9:15436283-15436305 AACTCCTAGAAGAAAACATATGG - Intronic
1051767875 9:20544201-20544223 AACTCCTAGAAGAAAACATAGGG + Intronic
1051945287 9:22562126-22562148 AACTCTTAGACAATAATACAGGG + Intergenic
1052106574 9:24524650-24524672 GACTCCCACACAATAACAATGGG - Intergenic
1052114437 9:24632689-24632711 AACTCCTAGAAGAAAACATAGGG - Intergenic
1052126988 9:24789319-24789341 GACTCCCACACAATAACAGCGGG + Intergenic
1052515071 9:29470355-29470377 GACTCCCACACAATAACAGTGGG - Intergenic
1053083987 9:35202460-35202482 GACTCCTACACAATAATAAGGGG - Intronic
1053088379 9:35248966-35248988 GACTCCTACACAATAATAATGGG - Intronic
1053546761 9:39031274-39031296 AGCTCCTATAAAATAACATAAGG - Intergenic
1053688947 9:40571053-40571075 AACTCCTAGAAGAAAACATAGGG + Intergenic
1053730393 9:41049657-41049679 AAATCCTAGAAAAGAACATAGGG - Intergenic
1053742288 9:41152382-41152404 GACTCCTACACAATAATAATGGG + Intronic
1053811078 9:41852928-41852950 AGCTCCTATAAAATAACATAAGG - Intergenic
1054275089 9:63060013-63060035 AACTCCTAGAAGAAAACATAGGG - Intergenic
1054300187 9:63371985-63372007 AACTCCTAGAAGAAAACATAGGG + Intergenic
1054399740 9:64704917-64704939 AACTCCTAGAAGAAAACATAGGG + Intergenic
1054433326 9:65189177-65189199 AACTCCTAGAAGAAAACATAGGG + Intergenic
1054497059 9:65832492-65832514 AACTCCTAGAAGAAAACATAGGG - Intergenic
1054619516 9:67334511-67334533 AGCTCCTATAAAATAACATAAGG + Intergenic
1055061686 9:72075046-72075068 GACTCCCACACAATAACAATGGG + Intergenic
1055168489 9:73225638-73225660 GACTCCTACACAATAATAGTGGG + Intergenic
1055178501 9:73351854-73351876 AACTCTTAGACGACAACATAGGG - Intergenic
1055819590 9:80245839-80245861 AACTCTTAGAAAAGAACATAGGG - Intergenic
1056184113 9:84115849-84115871 GACTCCTATACAATAACAGCTGG - Intergenic
1056401779 9:86234604-86234626 AACTCCTAGAATAAAACATAAGG + Intronic
1056562799 9:87747205-87747227 GACTACTACACAAAAACATTGGG - Intergenic
1058211195 9:102172306-102172328 GACTCCTACACAATAATAATGGG - Intergenic
1058632656 9:107005781-107005803 AACTACTAGACAAAAACAAAGGG - Intronic
1058905650 9:109480628-109480650 AACTCCTAGAAGAAAACATAGGG - Intronic
1059630897 9:116120855-116120877 GACTCCCACACAATAACAGTGGG + Intergenic
1060133708 9:121131242-121131264 GACTCCTACACAATAATAATGGG - Intronic
1060323869 9:122593757-122593779 GACTCCCACACATTAATATAGGG - Intergenic
1060776988 9:126382002-126382024 GACAAAGAGACAATAACATATGG - Intronic
1061948620 9:133922745-133922767 AACTCTTAGACAAAAACATAGGG + Intronic
1203459798 Un_GL000220v1:24169-24191 GACTCCCACACAATAACACTGGG - Intergenic
1203492453 Un_GL000224v1:119682-119704 AACTCCTACACAAAAATATAAGG - Intergenic
1203505076 Un_KI270741v1:61554-61576 AACTCCTACACAAAAATATAAGG - Intergenic
1186679046 X:11852788-11852810 GACTCCTACACAATAATAGAGGG + Intergenic
1186774485 X:12850904-12850926 GACCCATAGCCAATATCATACGG - Intergenic
1187183068 X:16961534-16961556 AACTCCTAGAAGAAAACATAGGG + Intronic
1187772074 X:22710562-22710584 AACTCTTAGAAAAAAACATAGGG + Intergenic
1188037665 X:25337028-25337050 GACTCCCACACAATAACAGTGGG - Intergenic
1188084391 X:25884814-25884836 GACTCCCACACAATAACAGTGGG + Intergenic
1188219573 X:27525141-27525163 GACTCCCACACAATAATAAAGGG - Intergenic
1188394218 X:29660437-29660459 AACTACTAGACAAAAACATTGGG - Intronic
1188806730 X:34600043-34600065 GACTTCCACACAATAACATTGGG - Intergenic
1188858276 X:35223815-35223837 GACTCCCACACAATAACAATGGG + Intergenic
1188863240 X:35283830-35283852 AACTACTAGACAGAAACATAGGG + Intergenic
1188893026 X:35634013-35634035 GACTCCCATACAATAACAGTGGG - Intergenic
1188946221 X:36306188-36306210 GACTCCAACACAATATAATAAGG - Intronic
1189866736 X:45338158-45338180 GACTCCTACACAATAATAGTGGG + Intergenic
1190494193 X:51012480-51012502 GACTCCCAGACAATAATAGTGGG - Intergenic
1191003310 X:55684765-55684787 GACTCCCAGACAATAATAATGGG - Intergenic
1191060762 X:56293476-56293498 GACTCCTAGACAATAATAATGGG + Intergenic
1191063434 X:56322171-56322193 GACTCCCAGACAATAATAATGGG + Intergenic
1191064002 X:56328602-56328624 GACTCCCAGACAATAATAATGGG - Intergenic
1191691363 X:63942042-63942064 AACTACTAGAAAAAAACATAGGG + Intergenic
1191708788 X:64124635-64124657 AACTACTAGAGAAAAACATAGGG + Intergenic
1191798408 X:65049269-65049291 AACTCCTAGAAGAAAACATAAGG - Intergenic
1191848274 X:65566381-65566403 GACTCCTACACAATAATAGTGGG - Intergenic
1191956531 X:66648441-66648463 GACTCCTACACAATAATAATGGG - Intergenic
1191972769 X:66835494-66835516 GACTCCAATACAATAACAAGTGG + Intergenic
1192006324 X:67217553-67217575 GACTCCCACACAATAATATTGGG - Intergenic
1192688216 X:73330146-73330168 GACTCCCAGACAATAATAATGGG - Intergenic
1192719231 X:73675342-73675364 GACTCCCAGACAATAATAATGGG - Intronic
1192761054 X:74097005-74097027 GACTCCCACACATTAATATAGGG - Intergenic
1192802295 X:74478098-74478120 GACTCCCACACAATAACAAGGGG - Intronic
1192827615 X:74714474-74714496 GACTCCCACACAATAACAATGGG + Intergenic
1192865149 X:75123130-75123152 AACTCCTAGAAGAAAACATAGGG - Intronic
1192891370 X:75394753-75394775 GACTCCAAAACAATAACAGCTGG + Intronic
1193030135 X:76888696-76888718 GACTCCCACACAATAACAATGGG + Intergenic
1193043605 X:77029635-77029657 GACTCCCAGACAATAATAGTGGG - Intergenic
1193061167 X:77209172-77209194 GACTCCTACACAATAATAATGGG - Intergenic
1193364933 X:80621038-80621060 GACTCCCAGACAATAATAGTGGG - Intergenic
1193486442 X:82090058-82090080 GACTCCTTGGCAAAAACACAGGG + Intergenic
1193615763 X:83686530-83686552 GACTCCCACACAATAACAGTGGG - Intergenic
1193661612 X:84265437-84265459 GACTCCCAGAAAATAATATTGGG - Intergenic
1193783024 X:85726690-85726712 GACTCCTACACAATAACAGTAGG - Intergenic
1193879112 X:86900061-86900083 GACTCCCACACAATAATAGAGGG - Intergenic
1193931644 X:87561043-87561065 AACTGCTAGAAAAAAACATAGGG + Intronic
1193999190 X:88406227-88406249 GACTCCTAAATAATAACAGTGGG + Intergenic
1194057964 X:89161600-89161622 GACTCCTACACAATAATAGTGGG - Intergenic
1194246059 X:91513133-91513155 GACTCCCAAACAATAACAATGGG + Intergenic
1194357221 X:92900763-92900785 GACTCCCACACAATAACAGTGGG - Intergenic
1194417342 X:93629850-93629872 GACTCCCACACAATAACAATGGG + Intergenic
1194593714 X:95833417-95833439 GACTCCTACACAAAAACAGTGGG - Intergenic
1194643155 X:96427525-96427547 GACTCCTACACAATAAAAGTGGG - Intergenic
1194747581 X:97645298-97645320 AACTCCTAGAAGAAAACATAGGG - Intergenic
1194961505 X:100241675-100241697 AACTCCTAGAAGAGAACATAGGG + Intergenic
1194989461 X:100530616-100530638 AACTCCTAGAAGAAAACATAGGG - Intergenic
1195395550 X:104406853-104406875 GACTCCCAGACAATAATAATGGG - Intergenic
1195541194 X:106065347-106065369 GACTCCTACACAATAATAGTGGG - Intergenic
1195844002 X:109206922-109206944 GACTCCCACACAATAATAAAGGG - Intergenic
1195848893 X:109261522-109261544 GACTCCAATACAATAACAAATGG - Intergenic
1195866901 X:109442350-109442372 CACTCCTAGACAATACCAAAAGG - Intronic
1196335347 X:114525652-114525674 AACTCCTAGAAGAAAACATACGG + Intergenic
1196479381 X:116128001-116128023 AATTCTTAGACAAAAACATAGGG + Intergenic
1196982430 X:121229829-121229851 GACTCCCACACAATAACAGTGGG - Intergenic
1197087464 X:122496073-122496095 GACTCCTACAAAATAACAGTGGG - Intergenic
1197158877 X:123301279-123301301 GACTCCCAGACAATAATAGTGGG - Intronic
1197514460 X:127408538-127408560 GACTCCAAGACAATAATATCTGG - Intergenic
1198295141 X:135280094-135280116 GACTCCCACACAATAATATTGGG - Intronic
1198646064 X:138807971-138807993 GACTCCCACACAATGACAAAGGG + Intronic
1198687332 X:139240365-139240387 GACTCCCATACAATAACAGTGGG + Intergenic
1198786119 X:140290313-140290335 GACTCCCACACAATAACAGTGGG - Intergenic
1198881685 X:141288075-141288097 GACTCCCACACAATAACAATGGG - Intergenic
1198974850 X:142325169-142325191 GACTCCTATACAATAATAGTGGG - Intergenic
1199095011 X:143727699-143727721 GACTCCTAAACAATAGTAGAGGG + Intergenic
1199229483 X:145419568-145419590 AACTCCTAGAAGAAAACATAGGG - Intergenic
1199302673 X:146231549-146231571 GACTCCCACACAATAACAATGGG - Intergenic
1199307997 X:146290502-146290524 GACTCCTACACAATAATAGTGGG - Intergenic
1199437552 X:147829341-147829363 GACTCCCACACAATAATATTGGG + Intergenic
1199567166 X:149228027-149228049 GACTCCTACAGAATAACAGTGGG - Intergenic
1199781370 X:151063613-151063635 AACTACTAGAAAAAAACATAGGG - Intergenic
1200382638 X:155855258-155855280 GACTCCCACACAATAATAAAAGG - Intergenic
1200389912 X:155934311-155934333 GACTCCCATACAATAATAAAGGG - Intronic
1200540368 Y:4449877-4449899 GACTCCTTCACAATAACAGTGGG + Intergenic
1200565027 Y:4754382-4754404 GACTCCCAAACAATAACAATGGG + Intergenic
1200574310 Y:4868882-4868904 GACTCCCACACAATAACAATGGG + Intergenic
1200665551 Y:6017763-6017785 GACTCCCACACAATAACAGTGGG - Intergenic
1201476625 Y:14389511-14389533 GACTCCCACACAATAATATTGGG - Intergenic
1201519786 Y:14860804-14860826 GACTCCTACACAATAATAGTGGG + Intergenic
1201533207 Y:15015190-15015212 GACTCCTACACAATAATAATGGG + Intergenic
1201626608 Y:16022044-16022066 GACTCCTACACAATAATAATGGG - Intergenic