ID: 914940071

View in Genome Browser
Species Human (GRCh38)
Location 1:152014727-152014749
Sequence GTGGCAGCCCAGAGGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914940067_914940071 -8 Left 914940067 1:152014712-152014734 CCAAACTGAGGTGTTGTGGCAGC 0: 1
1: 0
2: 0
3: 27
4: 155
Right 914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG 0: 1
1: 0
2: 3
3: 34
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914940071 Original CRISPR GTGGCAGCCCAGAGGATGGG AGG Intergenic
900632826 1:3646204-3646226 GTAGCAGCCCAAAGCACGGGCGG + Intronic
900659240 1:3774600-3774622 GTGGCTGCCCAGAGCAGGAGGGG - Intronic
900683883 1:3934695-3934717 TTGGCAGCACAGAGGATATGAGG - Intergenic
900955901 1:5886354-5886376 CTGGCAGCGCAGAGGTTGGTGGG - Intronic
901022900 1:6264008-6264030 TAGGCAGCCCAGATGCTGGGAGG - Intergenic
901138300 1:7011782-7011804 GTGCCAGCTCAGAGGCTGGCAGG + Intronic
901206641 1:7501309-7501331 CTGGCAGGCAAGAGGAAGGGAGG + Intronic
901660748 1:10796440-10796462 GCGGCAGCCCCGGGGGTGGGGGG + Intronic
902465155 1:16613080-16613102 GTGGCATCCCAGGGGGTGGAGGG - Intronic
902632304 1:17712290-17712312 GTGGCAGGTCAGAGGCTGAGAGG + Intergenic
903024270 1:20416231-20416253 GTGGCAGGGATGAGGATGGGAGG + Intergenic
903155652 1:21440591-21440613 GTGGCATCCCAGGGGGTGGAGGG + Intronic
903907838 1:26697959-26697981 GGGGCGGCCCAGAGGAAGGCCGG - Intronic
903944373 1:26952338-26952360 GTGGAGGCCCAGATGCTGGGCGG + Exonic
905362720 1:37431421-37431443 GCGGCAGCCCAAAGGCTGGGAGG + Intergenic
905868857 1:41391626-41391648 CCGGCAGCCCCGATGATGGGAGG + Intergenic
907385537 1:54123054-54123076 GTGCCAGGCCAAAGGCTGGGTGG - Intergenic
907860130 1:58345054-58345076 CTGGCAGCCCAGTGGAAGGTGGG - Intronic
909251614 1:73364145-73364167 GTGGTTGCCCTGAGGATGAGGGG - Intergenic
912355689 1:109053103-109053125 CTCACATCCCAGAGGATGGGCGG - Intergenic
912487417 1:110040129-110040151 GTGGCAGTCCAGTGCATGGCTGG + Intronic
912487958 1:110043902-110043924 GTGGCAGGCCTGAGGGTGTGAGG - Intronic
913043937 1:115057404-115057426 GTGGCAGCATAGAGGATTGATGG - Intronic
913600306 1:120415523-120415545 GTGGCATCCCAGGGGGTGGAGGG + Intergenic
914192650 1:145425081-145425103 GTGGCATCCCAGGGGGTGGAGGG - Intergenic
914361463 1:146939232-146939254 GTGGCATCCCAGGGGGTGGAGGG + Intronic
914491143 1:148151478-148151500 GTGGCATCCCAGGGGGTGGAGGG - Intronic
914590560 1:149103030-149103052 GTGGCATCCCAGGGGGTGGAGGG - Intronic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
915141845 1:153772849-153772871 GGGGCAGAGAAGAGGATGGGAGG + Intronic
915730668 1:158051874-158051896 GTGGAAGCTGAGAGGAAGGGAGG - Intronic
916756096 1:167771666-167771688 CTCACATCCCAGAGGATGGGCGG + Intronic
917931291 1:179824472-179824494 GTGGATGGCCAGAGGCTGGGTGG + Intergenic
919851220 1:201674286-201674308 GTTGCAGCAGAGAGGAAGGGTGG + Intronic
920631256 1:207654925-207654947 GAGGCAGCAAAGAGGCTGGGTGG + Intronic
920641785 1:207759375-207759397 GAGGCAGCAAAGAGGCTGGGTGG + Intronic
920846889 1:209601167-209601189 GTGCCAGCCTAGAGGACAGGAGG + Intronic
920964476 1:210690717-210690739 ATGACAGCCCAGAACATGGGAGG + Intronic
921237392 1:213147126-213147148 GAGACAGCCCATAGAATGGGAGG - Intronic
924673305 1:246150707-246150729 GTGGAAGTCCAGGGGTTGGGGGG + Intronic
1063688198 10:8258477-8258499 GAGTTAGCCCTGAGGATGGGAGG - Intergenic
1065960778 10:30732481-30732503 AGGGCAGCCCAAAGGATGGAAGG - Intergenic
1067069172 10:43119813-43119835 GTGGCAGGCCAGGGTGTGGGTGG - Intronic
1067363055 10:45600069-45600091 GTTGCAGCCAAGGAGATGGGAGG - Intergenic
1067478661 10:46581852-46581874 CTGGCAGGCCAGAGGAAGGCAGG - Intronic
1067616076 10:47759949-47759971 CTGGCAGGCCAGAGGAAGGCAGG + Intergenic
1068215435 10:53977122-53977144 GCTGCAGCCCAGGAGATGGGAGG - Intronic
1069832193 10:71288169-71288191 GGGGCTGCACAGAGGATGAGAGG - Intronic
1069889480 10:71644179-71644201 GTGGCTCCCCAGGGGATGTGGGG - Intronic
1070849957 10:79555586-79555608 GTGGCTGCGCAGAGGACGGAAGG + Intergenic
1071243860 10:83741129-83741151 AAGGCTGCACAGAGGATGGGGGG + Intergenic
1072013539 10:91323830-91323852 CTCGCATCCCAGACGATGGGCGG + Intergenic
1072715516 10:97749895-97749917 GCTGCACCCCAGGGGATGGGTGG - Intronic
1073020440 10:100439060-100439082 GTGAGAGCACAGAGGAAGGGAGG - Intergenic
1073238154 10:102035859-102035881 CTCACATCCCAGAGGATGGGCGG - Intronic
1074273643 10:111980041-111980063 GTGGTTGCCTAGGGGATGGGAGG - Intergenic
1074472737 10:113742209-113742231 GGGGAAGGCCAGAGGGTGGGGGG - Intergenic
1074787007 10:116849987-116850009 GCGGCAGCCCAGGGGCTGGCAGG + Intronic
1074983992 10:118641477-118641499 CTGGGAGACCAGAGGAAGGGAGG + Intergenic
1075011642 10:118875433-118875455 GTGGCAGAAGAGAGAATGGGAGG - Intergenic
1075163152 10:120042030-120042052 GTGGCAGCCCCCAGGGTGGTGGG + Intergenic
1076184547 10:128436018-128436040 GTGGCAGAAGAGAGGATGGTGGG + Intergenic
1076288227 10:129322248-129322270 GTGGCAGCAAAGGGGATGAGGGG + Intergenic
1076482202 10:130792165-130792187 GGGCCAGCCCAGGGGAAGGGAGG - Intergenic
1076705051 10:132296955-132296977 GAGGCAGCCCAGAGACAGGGAGG + Intronic
1076742849 10:132496525-132496547 GTGCCAGCCAAGGGGAAGGGTGG - Intergenic
1076830347 10:132991342-132991364 GAGGCCGCCGAGAGCATGGGTGG - Intergenic
1078470141 11:11579979-11580001 GTGGCTTCCTAGAGGATGAGAGG + Intronic
1078757445 11:14224294-14224316 TTGGAAGCACAGAGGAAGGGTGG + Intronic
1079242346 11:18729600-18729622 AGGGCAGCCCAGCGGGTGGGGGG + Intronic
1079823094 11:25156547-25156569 GAGGCAACCCACACGATGGGAGG - Intergenic
1079992061 11:27256508-27256530 GTGGCATGCGAGATGATGGGAGG - Intergenic
1081031191 11:38085552-38085574 GTGGCAGTCCCAAGGAAGGGTGG - Intergenic
1081521455 11:43885835-43885857 GTGGTAACACAGAGGATGAGAGG + Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083255344 11:61491952-61491974 GTGACAGCCCAGACCGTGGGTGG + Intergenic
1083716569 11:64580879-64580901 GTGGGAGCCCACAGGAAGGGGGG + Intergenic
1083826875 11:65208924-65208946 GTGGCAGCAAAGGGGAGGGGAGG - Intronic
1084164935 11:67371179-67371201 GCAGCAGCCCAGAGGGTGGAAGG - Intronic
1084520995 11:69662830-69662852 TTGGGAGCCCAGGGGAGGGGAGG - Intronic
1084860818 11:72016855-72016877 ATTGCTGCCCAGAGGATGGTGGG - Intronic
1085174382 11:74473631-74473653 GTAGAAGACCACAGGATGGGAGG - Intergenic
1085696377 11:78708302-78708324 GTGGCAGATGAGAGGATGAGTGG + Intronic
1085789139 11:79481524-79481546 GGGGCAGCCCAGAGGAGGAAGGG + Intergenic
1085806530 11:79641878-79641900 TTGGCAGCAGAGAGGATGGAAGG - Intergenic
1087163086 11:94970108-94970130 GTGAGAGCCCAGAAGATTGGAGG + Intronic
1087188009 11:95222699-95222721 ATGGCAGTCCAGAGGATAGAAGG + Intronic
1090283226 11:125476126-125476148 GTGGTTGCCCAGAGATTGGGCGG + Intronic
1091160631 11:133416466-133416488 GTGGCTTCCCAGAGGAGGTGAGG - Intronic
1091613480 12:2031397-2031419 GTGGCAGCACGGTGAATGGGGGG + Intronic
1092098123 12:5861237-5861259 TTGGCAGCCCTCAGGATGGAAGG - Intronic
1092140848 12:6182479-6182501 GTGGGAGGCCCCAGGATGGGCGG + Intergenic
1094004669 12:25737011-25737033 GTGGGAGCCCAGAGGAGGTATGG + Intergenic
1096088196 12:48880497-48880519 CTGGCAAAACAGAGGATGGGAGG - Intergenic
1096284115 12:50283431-50283453 GTAGCAGCGCAGAGGAAAGGCGG - Exonic
1097110155 12:56652122-56652144 CTCGCATCCCAGATGATGGGCGG + Intergenic
1097232888 12:57522954-57522976 GTCGCGGCCCAGAGGGTGAGTGG - Exonic
1097260309 12:57716172-57716194 GTGGCACCCCAAAAGATGGCAGG + Exonic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1099927255 12:89032987-89033009 GTGGGAGCCAAAAGGATGGGAGG - Intergenic
1099964441 12:89430606-89430628 TCGCCAGCCCAGAGGGTGGGTGG - Intronic
1101637871 12:106561128-106561150 GGGCCAGCCCAGAGAAGGGGTGG - Intronic
1101718263 12:107330118-107330140 GTGGCAGGGGAGAGCATGGGGGG + Intronic
1101901495 12:108794252-108794274 TTGGAAGCCCAGAGCCTGGGCGG - Intronic
1102225568 12:111225923-111225945 GGGGCAGTAGAGAGGATGGGAGG - Intronic
1102381325 12:112469094-112469116 CTGGCAGACCTGATGATGGGTGG + Intronic
1102455105 12:113066070-113066092 GTGTCAACCCAGAGGCTGGGTGG - Intronic
1103726266 12:122998762-122998784 GTGCCAACACAGAGGCTGGGTGG + Intronic
1103792184 12:123479551-123479573 CTGTGAGCCCAGAGGCTGGGAGG - Intronic
1104066572 12:125311739-125311761 CGGGCAGGCCAGAGGATGTGTGG + Intronic
1104363431 12:128154958-128154980 GTAGCAGATCAGAGGATGGATGG + Intergenic
1104887350 12:132118496-132118518 GGGGCTGCCCAGGGGAGGGGCGG - Intronic
1105891436 13:24685204-24685226 GTAGCAGCCCTGAGGATGGGAGG - Intronic
1105986642 13:25573691-25573713 GTGGCAGCCCTGGTGCTGGGTGG + Intronic
1106101499 13:26697682-26697704 GTGGCATCCCAGGGTTTGGGGGG - Intergenic
1108248702 13:48543123-48543145 GGGGCAGCCGAGTGGGTGGGTGG - Intergenic
1108351235 13:49592596-49592618 CTCACAGCCCAGACGATGGGCGG - Intergenic
1108639179 13:52366248-52366270 TTGGAAGCTCAGAGGATGGTGGG + Intergenic
1108650763 13:52477323-52477345 TTGGAAGCTCAGAGGATGGTGGG - Intergenic
1110558230 13:76884975-76884997 GAAGCAGCCCAGAGGATTTGCGG + Exonic
1113055427 13:106262126-106262148 GTGGCAGCCAAGAACAAGGGAGG - Intergenic
1114530334 14:23391478-23391500 GGGGCATCCAAGAAGATGGGAGG + Intronic
1115622400 14:35152931-35152953 CTCGCATCCCAGACGATGGGCGG + Intronic
1118100175 14:62590424-62590446 GTGACAGCCAAGAGAATGGCTGG - Intergenic
1118815807 14:69313174-69313196 GCTGTAGCCCAGAGTATGGGGGG - Intronic
1119764970 14:77182285-77182307 GTCCCAGCCCAGAGAGTGGGCGG - Intronic
1120497219 14:85252457-85252479 CTACCAGCCCAGAGGATTGGAGG + Intergenic
1120994837 14:90409179-90409201 ATTGCAGCCTAAAGGATGGGAGG + Intergenic
1121515057 14:94544042-94544064 GTGGCAGCCAGGAGGCTGTGTGG - Intergenic
1122014251 14:98780342-98780364 GTGGAAGCCCAGATGATGTGGGG + Intergenic
1122116682 14:99531114-99531136 GTGGCAGGCCAGGGGAGAGGTGG + Intronic
1122129232 14:99595595-99595617 CTGGGAGCTCAGAGGAGGGGTGG - Intronic
1122407726 14:101510123-101510145 GTGGCAGCCCACACTAAGGGAGG + Intergenic
1122838146 14:104441404-104441426 GAGACAGCCCAGTGGATGGTGGG + Intergenic
1122890482 14:104729914-104729936 GTGGCAACCCAGAGGCAAGGAGG + Exonic
1122900982 14:104782265-104782287 GTGGCAGCTGGCAGGATGGGAGG - Intronic
1122957368 14:105076931-105076953 GGGGCAGGCCAGAGGGCGGGTGG + Intergenic
1122969105 14:105145260-105145282 GGGTCCGCCCTGAGGATGGGCGG - Intronic
1123118774 14:105907482-105907504 CTGGCAGAACAGAGGAGGGGAGG - Intergenic
1124032067 15:26020776-26020798 CTGGCAGCACAGAGTCTGGGGGG + Intergenic
1125750406 15:42023903-42023925 GAGGCACCACAGAGGATGTGGGG - Intronic
1125919287 15:43515970-43515992 GTGGCAGCTGAGAATATGGGTGG + Intronic
1126103235 15:45132068-45132090 GGGGGAGCCCAGAGGATGCTGGG - Intronic
1126521688 15:49602578-49602600 GAGACAGCCCATAGAATGGGAGG - Intronic
1127072820 15:55302529-55302551 CTCGCATCCCAGACGATGGGCGG - Intronic
1127079016 15:55357423-55357445 GTAGCAGCCTAGAGGATTGATGG - Intronic
1128137611 15:65275607-65275629 GTGGCTGCCAAGAGGAAGAGTGG + Intronic
1128758018 15:70196399-70196421 GTGGCAGGCCAGGGGAGGAGGGG - Intergenic
1129334419 15:74843673-74843695 GGGGCAGCCCACAGGATTAGGGG - Intergenic
1129457378 15:75683094-75683116 GTGGCAGCCCAGGGCCGGGGAGG - Intronic
1129692427 15:77721357-77721379 GTGTGAGCCGAGAGGGTGGGAGG - Intronic
1129714725 15:77840392-77840414 GAGGCAACCCAGAGGACAGGTGG + Intergenic
1129880522 15:79003635-79003657 GAGGCAGCACAGAGTCTGGGCGG - Intronic
1130274448 15:82469199-82469221 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130466795 15:84196573-84196595 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130497469 15:84476963-84476985 GTGGCAGCCCAGGGCCGGGGAGG - Intergenic
1130589090 15:85201166-85201188 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1131344226 15:91631138-91631160 GGGCCAGCCCAGAGGGTGGGTGG + Intergenic
1131592996 15:93769304-93769326 CAGGCAGCCCAGGGGAAGGGTGG + Intergenic
1132058346 15:98669682-98669704 AAGGCTGCCCAGAGGATGGAGGG - Intronic
1134078910 16:11311457-11311479 CTGGCAGCCAAGCAGATGGGAGG - Intronic
1134096266 16:11420936-11420958 CTGTCATCCCAGAGGGTGGGTGG - Intronic
1135631021 16:24035626-24035648 GGGGCAGTCCAGTGGAGGGGTGG + Intronic
1135694604 16:24575303-24575325 CTCACATCCCAGAGGATGGGTGG + Intergenic
1136269965 16:29142607-29142629 GGGGCAGGCAAGAGGCTGGGGGG - Intergenic
1137772037 16:51024254-51024276 GTGCCAGCCCATGGGATGGGAGG - Intergenic
1138458239 16:57133338-57133360 CTGGCAGCCCAGGGGAGGGGAGG - Intronic
1138522510 16:57578849-57578871 GTGGCAGCACCGAGGAGGAGGGG - Intronic
1138561562 16:57803573-57803595 CTGGCAGCCCAGCGCCTGGGCGG - Intronic
1139513448 16:67440144-67440166 GGGGCTGCCTGGAGGATGGGAGG - Intronic
1140415412 16:74770736-74770758 CTGGCAGCCCAGTGGAGGGCTGG + Intronic
1141364078 16:83426193-83426215 GTGGAAACCCAGAGGCTGGGAGG - Intronic
1141493918 16:84393712-84393734 ATGGGAGGCCAGTGGATGGGAGG + Intronic
1141717674 16:85736118-85736140 GAGGAACCCCAGGGGATGGGAGG + Intronic
1141728809 16:85808515-85808537 CTCGCATCCCAGACGATGGGCGG + Intergenic
1141754160 16:85980194-85980216 GCTGCAGCCTAGAGGATGGGAGG + Intergenic
1142012362 16:87722264-87722286 GTGGCAGCGCAGAGCCTGGAGGG + Intronic
1143885643 17:10062938-10062960 GGGGCAGCCCAGGGGAAGGCAGG + Intronic
1144835771 17:18155983-18156005 GTGTCAGCCCAAAGGGTGGTAGG + Intronic
1146759120 17:35460677-35460699 GTGGCAGCCCAGCGGGGCGGGGG - Intergenic
1146804498 17:35854583-35854605 GAGGCAGCAGAGAGGATGGTTGG + Intronic
1147155533 17:38542785-38542807 GGGGCAGCTCAGAGGAGGAGAGG - Intronic
1147170281 17:38614481-38614503 GGGCCAGCACAGAAGATGGGTGG - Intergenic
1147272948 17:39289561-39289583 GTGGGAGCCCAGGAGATGGAGGG + Intronic
1148215908 17:45833939-45833961 GGGGCAGCCCAGAGGCTGGGTGG + Intronic
1148216049 17:45834553-45834575 GTGGCGGCCCAGGGGAGGGAGGG + Intronic
1148578663 17:48728383-48728405 GGGGCACCCCAGGGCATGGGTGG + Exonic
1148618252 17:49015635-49015657 GTGGAAGCACAGAGAATGGGGGG - Intronic
1148712477 17:49691872-49691894 GTGAAAGACCAGAGGAAGGGAGG + Intergenic
1149526511 17:57360074-57360096 GTGGCTGCCCAGAGCAGGCGAGG + Intronic
1150123074 17:62619326-62619348 GTGAGAGCCCAGAGGAAGGCTGG - Intergenic
1150780353 17:68116520-68116542 CTCGCATCCCAGACGATGGGCGG + Intergenic
1151346817 17:73507400-73507422 CTGGCAGCCAGGAGGAAGGGCGG + Intronic
1151570373 17:74922829-74922851 GAGGCAGCTCAGAGGAGTGGTGG + Intronic
1152264303 17:79285173-79285195 GTTACAGCCCAGAGGAGGGTTGG - Intronic
1152276243 17:79359233-79359255 CTGGCAGCCCTGGGGAGGGGCGG - Intronic
1152363635 17:79843499-79843521 GTGGCTGCCCTGACGTTGGGAGG - Intergenic
1152614321 17:81330915-81330937 ATGGCTGCCCGGAGGAAGGGAGG + Intergenic
1152629854 17:81406034-81406056 GGGGCACCCCAAAGGCTGGGCGG - Intronic
1152672617 17:81618112-81618134 GTCACATCCCAGACGATGGGCGG - Intronic
1153942641 18:9991010-9991032 CTGGCTTCCCAGAGGATGGGAGG + Intergenic
1154420208 18:14222782-14222804 CTCACATCCCAGAGGATGGGCGG - Intergenic
1154420847 18:14225048-14225070 CTCACATCCCAGAGGATGGGTGG - Intergenic
1155925252 18:31649086-31649108 GAGGCAGCACAGAGTGTGGGAGG - Intronic
1157056461 18:44234771-44234793 GTAGGAGCTCAGAGGAAGGGAGG + Intergenic
1157612083 18:48963484-48963506 GTAGCAGCCCTCAGGCTGGGGGG + Intergenic
1158618523 18:59009974-59009996 GGGGCAGCTCAGAGGAGGGAGGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160459399 18:79026542-79026564 GTGGCAGCAGAGAGCATGTGGGG + Intergenic
1160465492 18:79072937-79072959 GTCACATCCCAGACGATGGGCGG + Intronic
1160793402 19:933195-933217 CTGGCAGCCGAGGGGATGTGGGG + Intronic
1161080482 19:2307834-2307856 TTGGCGCCCCAGAGGAGGGGCGG + Intronic
1161273639 19:3404011-3404033 GGGGCAGGCCAGGGGCTGGGGGG - Intronic
1161471294 19:4457844-4457866 GTGGCAGGCCAGGGGAAGGCGGG - Intergenic
1161756137 19:6135699-6135721 GTGGGAGGCAGGAGGATGGGTGG - Exonic
1161776134 19:6263260-6263282 GAGGCAGAACAGAGGAAGGGTGG + Intronic
1161808590 19:6459095-6459117 GTAGGTGCCCAGAGGATGGAGGG + Intronic
1161854003 19:6753455-6753477 GTGGCAGCCCAGCGCCTGCGAGG - Exonic
1161977995 19:7616660-7616682 GTGGCTTCCCAGAGCCTGGGAGG + Intronic
1162324870 19:9993122-9993144 GGGGCTGCCCAGATGAGGGGAGG - Intronic
1162530430 19:11232983-11233005 GTGACTGACCCGAGGATGGGTGG - Intronic
1162602201 19:11677417-11677439 CTCGCATCCCAGATGATGGGCGG + Intergenic
1162937267 19:13987433-13987455 GTGGCAGGGAAGAGGAAGGGAGG - Intronic
1163700575 19:18784748-18784770 GCGGGAGCCCAGAGGAGGGCTGG + Intronic
1164573728 19:29392844-29392866 GTGGCAGCCTTGAGTCTGGGTGG + Intergenic
1164779500 19:30880957-30880979 GGGGCAGCCGAGAGGAAGGGCGG + Intergenic
1164898271 19:31896435-31896457 GAGGCAGCCAAGAGGAAGAGGGG + Intergenic
1165099036 19:33427437-33427459 TTGGCTCCACAGAGGATGGGAGG + Intronic
1165799078 19:38536725-38536747 GGGGCAGCCAACAGGATGGGAGG - Intronic
1166033056 19:40147518-40147540 GTGTCTACCCAGAGGAAGGGAGG - Intergenic
1166662682 19:44657527-44657549 GTGGAAGCCCTGAGGAGAGGTGG + Intronic
1167108621 19:47446126-47446148 GCGGAAGCGCAGAGGCTGGGAGG + Intronic
1167290650 19:48623554-48623576 TTGGAAGCCCAGGGGCTGGGAGG - Intronic
1167556019 19:50196192-50196214 GTGGCAGGGCATGGGATGGGAGG + Intronic
1167958899 19:53090388-53090410 ATGGCAACGCAGAGGATGGGTGG - Intronic
925007728 2:457270-457292 GGAGCAGTCCAGAGGAGGGGTGG + Intergenic
926156150 2:10455027-10455049 GTGGGAGCCTGGAGGATGGGCGG - Intergenic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
926419932 2:12686195-12686217 GAGGCAGCACAGAGCATGGAGGG - Intergenic
928009535 2:27594555-27594577 GTCACATCCCAGATGATGGGCGG + Intronic
928689541 2:33785015-33785037 GTGGCAGATGAGAGGATGGATGG - Intergenic
929339131 2:40791681-40791703 GTTCCAGCCCAGAGGCTGGCAGG + Intergenic
929382055 2:41365111-41365133 GTGGTTGCTCAGAGGAGGGGAGG - Intergenic
932421378 2:71603410-71603432 GAGCCAGGCCAGAGGGTGGGTGG + Intronic
932497367 2:72153074-72153096 GGTGCAGGCCAGAGGCTGGGAGG - Intergenic
933868559 2:86545903-86545925 CTCACATCCCAGAGGATGGGCGG + Intronic
934519374 2:95010355-95010377 CTGGAAGCCCGGAGGCTGGGTGG + Intergenic
934580116 2:95430998-95431020 ATGGCAGCCCTGAGGATAGAGGG - Intergenic
934599331 2:95645727-95645749 ATGGCAGCCCTGAGGATAGAGGG + Intergenic
934609848 2:95727021-95727043 GGGTGAGCCCAGAGGCTGGGAGG + Intergenic
934752603 2:96803181-96803203 GAGCAAGCCCAGAGGAGGGGAGG - Intronic
934899481 2:98146600-98146622 GTGGCAGCTCTGAGGAAGTGGGG - Intronic
936532675 2:113287735-113287757 ATGGCAGCCCTGAGGATAGAGGG + Intergenic
937886490 2:126902802-126902824 GTGACAGCCCAGAGAAGGGCAGG + Intergenic
937917243 2:127105365-127105387 ATGGCAGCCCGGAGCAGGGGTGG + Intronic
938082205 2:128376268-128376290 GTGGCAGTCCAGAAGGTGGGAGG + Intergenic
938291604 2:130153620-130153642 GTGGCTGACCACAGGCTGGGTGG + Intronic
938299766 2:130201614-130201636 GTTGGAGCCCTGAGGAAGGGGGG - Intergenic
938381948 2:130841544-130841566 CTGGCACGACAGAGGATGGGAGG - Intronic
938464947 2:131519343-131519365 GTGGCTGACCACAGGCTGGGTGG - Intergenic
938983967 2:136554890-136554912 CTGGCAGCCCAGAGTAGGGAGGG + Intergenic
940396431 2:153196751-153196773 GTGGCAGCCCCCAGGGTGGTGGG + Intergenic
942455261 2:176133797-176133819 GTGGGAGCCCTGTGTATGGGTGG + Intergenic
945949246 2:216023214-216023236 GTGGCAGCACAGAGGATTATAGG - Intronic
945983898 2:216339390-216339412 GTGGGAGCCTGAAGGATGGGTGG - Intronic
947346847 2:229200590-229200612 GTGGGAGCTCAGTGGTTGGGAGG - Intronic
948205633 2:236161518-236161540 GGGACAGCCCAGACGAAGGGAGG - Intergenic
948884036 2:240874191-240874213 TTGGCCTCCCAGAGGGTGGGCGG - Intronic
1168835292 20:873619-873641 ATGGGGGCCCAGAGGAAGGGAGG - Intronic
1168913321 20:1467055-1467077 GTGGGAGCCCGAAGGATGAGAGG + Intronic
1169369958 20:5021054-5021076 GTAGCTGCCCAGAGCCTGGGAGG + Intergenic
1169545897 20:6650334-6650356 GTTGCTGCCCAGAGCATGGTTGG - Intergenic
1169723196 20:8701262-8701284 GTTGGAGCCCAGTGGATGAGGGG - Intronic
1171053398 20:21882964-21882986 GTGGTAGCTCAGAGCAAGGGAGG + Intergenic
1171094954 20:22323575-22323597 ATGCCAGCCCAGAGGAAGGGTGG + Intergenic
1171207343 20:23291154-23291176 GTGGCAGGTCAGAGAATGGCAGG - Intergenic
1171231744 20:23492486-23492508 GGGAAACCCCAGAGGATGGGAGG + Intronic
1172164984 20:32893513-32893535 GTGGCCTCTCTGAGGATGGGAGG + Intronic
1173920640 20:46742358-46742380 GTGCTAGGACAGAGGATGGGAGG + Intergenic
1174158217 20:48531062-48531084 ATGGCAGCCCAGAAGAAGGACGG + Intergenic
1174726274 20:52865595-52865617 GTGGCTGGTGAGAGGATGGGAGG - Intergenic
1175049660 20:56143003-56143025 GGGGGTGCCCAGAGGATGAGAGG - Intergenic
1175479888 20:59303233-59303255 GTGTCCACCTAGAGGATGGGAGG + Intronic
1175831128 20:61965940-61965962 GTGGCAGGCCAGGGGAGGGGCGG - Intronic
1175872532 20:62215221-62215243 GTGTGAGCCCAGAGGCGGGGTGG + Exonic
1175874670 20:62223717-62223739 GTGGCAGCCCAGACCCTGGTGGG - Intergenic
1176387527 21:6146203-6146225 GTACCAGCCCAGAGGGTGGAGGG - Intergenic
1176853124 21:13936683-13936705 CTCACATCCCAGAGGATGGGCGG + Intergenic
1178804462 21:35826832-35826854 TTGGCATCACAGAGCATGGGTGG - Intronic
1179735945 21:43392045-43392067 GTACCAGCCCAGAGGGTGGAGGG + Intergenic
1179890861 21:44334490-44334512 GTGCCCGCCCAGAGGTTGAGGGG - Intronic
1179890883 21:44334532-44334554 GTGCCCGCCCAGAGGTTGAGCGG - Intronic
1180054995 21:45353010-45353032 GTGTCAGCCGGGAGGATGCGGGG + Intergenic
1180109794 21:45642663-45642685 GAGCCAGCCCAGAGAAAGGGCGG + Intergenic
1180182475 21:46124163-46124185 GTGGGTGGACAGAGGATGGGTGG + Intronic
1181130186 22:20726652-20726674 GGGAAAGCCCAGAGGATGGCAGG + Intronic
1181513196 22:23397902-23397924 GTGGCACCACGGCGGATGGGTGG + Intergenic
1181531300 22:23519001-23519023 GTGACAGCGCGGAGGAGGGGAGG + Intergenic
1181636831 22:24178380-24178402 ATGGGAGCCCAGAGGAGGAGGGG + Exonic
1181636968 22:24178960-24178982 GGGGCAGCTGAGAGGCTGGGAGG + Intergenic
1181671442 22:24427339-24427361 GTGGCTGCAATGAGGATGGGAGG - Intronic
1182149414 22:28017829-28017851 GTGTTAGCCCTGGGGATGGGGGG - Intronic
1182435535 22:30327124-30327146 TTGGCAGCCCGGAGGAGGGCGGG - Intergenic
1182632262 22:31695739-31695761 GTTGCAGCCCATTGGATGGGTGG - Intronic
1183511367 22:38237090-38237112 GGGGCAGCTGAGAGGCTGGGTGG - Intronic
1184140783 22:42576434-42576456 GTGGCGCCCCAGAGGGAGGGCGG - Intergenic
1184940240 22:47759692-47759714 GTGGGAGCCCATAGGATGGAGGG + Intergenic
949404989 3:3705073-3705095 GAGGCAGCCCAGTGGAGGCGCGG + Intronic
949949947 3:9220944-9220966 GTGGGACCTGAGAGGATGGGAGG - Intronic
949988681 3:9559852-9559874 CTCACATCCCAGAGGATGGGCGG - Intergenic
952316762 3:32238665-32238687 GTGGAGGCCCGGAGGAGGGGAGG - Exonic
952816707 3:37452804-37452826 GTCCCAGCCCAGAGCGTGGGGGG + Intronic
953695161 3:45152525-45152547 GAGTCAGCCCAGTGGATGGGAGG + Intergenic
954114655 3:48459675-48459697 GTGGCAGCCTAGAGGACAGTTGG + Intronic
954220908 3:49153353-49153375 CTGGCAGCTCTGAGGTTGGGTGG + Intergenic
954318466 3:49814084-49814106 GTGTCAGACCTGAGGGTGGGAGG + Intergenic
954748125 3:52798520-52798542 GTGGGTGCCAAGAGGAGGGGAGG - Intronic
955670142 3:61393927-61393949 CTCACATCCCAGAGGATGGGCGG + Intergenic
956007947 3:64800459-64800481 GTGGTTCCCCAGGGGATGGGAGG - Intergenic
958106315 3:89077906-89077928 GGGGCCTCTCAGAGGATGGGGGG + Intergenic
959187933 3:103070691-103070713 GGGGCAGCCCAGAGGATATGCGG - Intergenic
959996971 3:112690854-112690876 GGGGCCTACCAGAGGATGGGAGG - Intergenic
960378327 3:116930104-116930126 GTGGAAGCGCAAAGGATGGCAGG + Intronic
961175712 3:124833623-124833645 GAGGCAGCCTGGTGGATGGGAGG + Intronic
961563198 3:127745745-127745767 GCTGCATCCCAGAGGATGGATGG - Intronic
961628044 3:128277056-128277078 GTGCCAGGCCAGAGGGTGAGAGG - Intronic
962090815 3:132242350-132242372 GTGGCATCCCAGACAGTGGGTGG + Intronic
962347172 3:134626566-134626588 GTGGCAGCCCTGACGACGTGTGG - Intronic
962709024 3:138070141-138070163 GTGGGAGCTCAGAGGAGGGAGGG - Intronic
962826464 3:139104387-139104409 ATGGGAGTCCAGAGGAGGGGTGG - Intronic
965938338 3:174144067-174144089 GTGGCATGTCAGAGGGTGGGAGG - Intronic
966320746 3:178699040-178699062 GTGGATGCCCACAGGATGGCAGG - Intronic
966803740 3:183789062-183789084 GAGACAGCCCACAGAATGGGAGG - Intronic
966945837 3:184776634-184776656 GCCCCAGCCCAGAGGTTGGGCGG + Intergenic
967178752 3:186885094-186885116 CTCACATCCCAGAGGATGGGCGG + Intergenic
967201243 3:187074311-187074333 CAAGCATCCCAGAGGATGGGGGG - Exonic
967245705 3:187484265-187484287 CTGGCAGTCCAGAGGAAGGAAGG - Intergenic
967886356 3:194336376-194336398 GAGGCTGCCCAGGGCATGGGAGG - Intergenic
968453290 4:684970-684992 GCTGCAGACCAGAGGTTGGGAGG - Intronic
968531270 4:1093022-1093044 GTGGTAGGGCAGAGGCTGGGTGG + Intronic
968611993 4:1561529-1561551 GGGGCTGCACAGAGGCTGGGTGG + Intergenic
968964104 4:3760775-3760797 GTGGCAACCGAGAGGGTCGGGGG + Intergenic
969336782 4:6515371-6515393 GTGCCAGGCCAAAGGCTGGGAGG + Intronic
969615225 4:8248020-8248042 GTGGGACCCCAGAGCATAGGTGG - Intergenic
970445965 4:16123573-16123595 CTGGCAGCCAAGAGGATGAAAGG + Intergenic
972601984 4:40581042-40581064 GTGGGAGCACAGAGGTTGGGAGG + Intronic
972939671 4:44181702-44181724 CTGGCATCCCAGACAATGGGCGG - Intronic
974952922 4:68603758-68603780 GAAGCTGCCCAGAGCATGGGGGG - Intronic
975908738 4:79245197-79245219 CTCGCATCCCAGATGATGGGCGG - Intronic
976390116 4:84498028-84498050 GTGGGTGCCCAGAGGCGGGGAGG + Exonic
979941701 4:126771058-126771080 CTCACATCCCAGAGGATGGGCGG - Intergenic
979948989 4:126867888-126867910 GTGGCAGGCAAGAGAATGTGTGG - Intergenic
980980002 4:139646674-139646696 GGCTCAGCCCATAGGATGGGAGG - Intergenic
981027880 4:140094936-140094958 GTGGCAGCCCAGTGGAGGTCTGG + Intronic
981994761 4:150963640-150963662 CTCGCATCCCAGACGATGGGCGG - Intronic
982488451 4:155998340-155998362 TTGGAAACTCAGAGGATGGGAGG - Intergenic
984059974 4:174979549-174979571 GTGGCAACCCAGATTAAGGGTGG + Intergenic
985485949 5:149579-149601 AAGGCAGCCCACAGAATGGGGGG + Intronic
985554533 5:551222-551244 GTGGCTGCCCGGGGGTTGGGAGG + Intergenic
985731880 5:1553961-1553983 GTGGCCGCCCACAGGGTGAGGGG + Intergenic
985808726 5:2067970-2067992 GTGACAGCCCAGGGGTGGGGAGG + Intergenic
986297370 5:6449975-6449997 GAGGCAGCCCAGAAGAAGGCAGG - Intronic
988264453 5:28929627-28929649 CTCACATCCCAGAGGATGGGCGG + Intergenic
988371254 5:30370942-30370964 GTGAAGGCCCAGAGGCTGGGAGG - Intergenic
988510352 5:31859238-31859260 GAGCCAGCCAAGAGAATGGGGGG - Intronic
988636881 5:32994487-32994509 GTGGGAGCTTAGAGGAAGGGAGG + Intergenic
990601633 5:57364702-57364724 GCAGCAGGCCAGAGGGTGGGTGG + Intergenic
991080105 5:62589337-62589359 GTGGTATCCCAGAAGATGAGAGG - Intronic
991347044 5:65680167-65680189 GTTGGAGGGCAGAGGATGGGAGG + Intronic
992800719 5:80293400-80293422 AAGGCAGCCCACAGAATGGGAGG + Intergenic
994204987 5:97024649-97024671 TTGCCAGCTCAGAGGATGTGCGG + Exonic
997188769 5:131909622-131909644 GTGACAACCCATAGAATGGGGGG + Intronic
997234704 5:132266058-132266080 GTAGATGCCCAGAGGATGCGTGG + Intronic
998349330 5:141490763-141490785 ATGTCAACCCAGAGGATGGACGG + Exonic
1000971582 5:167720784-167720806 GTGGAAGCCCAGAGGAAGGAAGG + Intronic
1001045106 5:168365505-168365527 GAGGCAGCTCAGAGGAGGAGAGG - Intronic
1001304251 5:170560202-170560224 CTGGAAGCCCAGAGGCTGAGAGG - Intronic
1002108044 5:176889889-176889911 GTGGGAGCCCAGAGCATCTGTGG - Intronic
1002836049 6:865958-865980 GTCTCAGCCCAGAGGAGGGCAGG - Intergenic
1003022109 6:2518816-2518838 GTGGAATACCAGAGGATGAGAGG + Intergenic
1003266446 6:4568580-4568602 AGGGCAGCCCAGAGGTTGAGGGG + Intergenic
1003302999 6:4901935-4901957 GTGGCAGCCCAGAGCTGCGGGGG - Intronic
1006168563 6:32080068-32080090 ATGACAACCCAGAGGAAGGGAGG + Intronic
1006340226 6:33442737-33442759 GTGGCAGCCCTGAAGAGGGCAGG - Intronic
1006750393 6:36373275-36373297 GGTGCAGCACAGAGGAAGGGCGG + Intronic
1007276596 6:40678751-40678773 GTGTCACCCCAGGGGATGGCTGG + Intergenic
1007417179 6:41698557-41698579 GTGCAAGCCCAGAGGCTGGGAGG + Intronic
1007920358 6:45603810-45603832 GTGGCAGGCAAGAGAATGTGTGG + Intronic
1008263478 6:49395204-49395226 GTGGCAGGCAAGAGCATGTGCGG - Intergenic
1011818657 6:91224081-91224103 GTGGCCGGTCAGAGGGTGGGGGG + Intergenic
1013292035 6:108728161-108728183 ATGGCAGCCCAGGGGAGGGAAGG + Intergenic
1013342206 6:109225825-109225847 GAGGCTGCCCAGAGGGTGAGGGG + Intergenic
1015467384 6:133561998-133562020 GTGGCCACCCAGATGAAGGGTGG + Intergenic
1016276001 6:142353185-142353207 GTGGGAGCCCATAGCTTGGGTGG - Intronic
1017812419 6:157993467-157993489 GAGACAGCCCACAGAATGGGAGG - Intronic
1018314986 6:162547927-162547949 GTGGGAGACCAGTGGATGTGAGG - Intronic
1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG + Intronic
1020281720 7:6653371-6653393 GTGGAAGCCCAGCGGGTGGGAGG - Exonic
1020831633 7:13102409-13102431 CTCGCATCCCAGACGATGGGCGG - Intergenic
1022757011 7:33303962-33303984 CTCACATCCCAGAGGATGGGCGG - Intronic
1022948584 7:35313949-35313971 GTAGCAGCCAAGAGAATGGGAGG - Intergenic
1023162236 7:37308745-37308767 CTGGCTGCCCAGATGATGAGTGG + Intronic
1023609856 7:41961797-41961819 GTGGCAGTCCAGTGGAAGGAAGG - Exonic
1023941223 7:44769333-44769355 GTGGGAGCCCAGAGGCTGCAGGG + Exonic
1024233557 7:47380888-47380910 GTGGCATGCCAGAGGAGGGCGGG + Intronic
1024262013 7:47580508-47580530 GTGGTAGCACAGGGGGTGGGGGG - Intronic
1024558981 7:50627928-50627950 CTGGGAGCCCAGCGGGTGGGTGG - Intronic
1024707084 7:51972560-51972582 GTGTCATCCCAGAGGCTGGAAGG + Intergenic
1025775087 7:64554040-64554062 CTCACATCCCAGAGGATGGGCGG - Intronic
1026007956 7:66614524-66614546 CTCGCATCCCAGACGATGGGCGG - Intergenic
1026742941 7:72990331-72990353 CTGGGAGCCCAGAAGGTGGGGGG + Intergenic
1027100794 7:75374747-75374769 CTGGGAGCCCAGAAGGTGGGGGG - Intergenic
1028669551 7:93385980-93386002 GTGGAAACACAGAGGATGGAGGG + Intergenic
1029283580 7:99451789-99451811 GAGGCAGCCGGGAGGAAGGGAGG - Intronic
1029551176 7:101237876-101237898 GGGGCAGCCCAGAGGCTGGGGGG - Intronic
1030314326 7:108098404-108098426 CTGGCAGCCCAGGGGGTCGGTGG + Exonic
1032056589 7:128689256-128689278 CTCGCATCCCAGACGATGGGCGG - Intergenic
1032263186 7:130352510-130352532 GGGGCTGGCCAGAGGAAGGGGGG + Intronic
1033565625 7:142575379-142575401 CTCACATCCCAGAGGATGGGCGG - Intergenic
1033581933 7:142745972-142745994 GAGGCAGTCAAGAGGAGGGGCGG + Intergenic
1033643612 7:143285171-143285193 GAGGTAGCCCAGTGGCTGGGAGG - Exonic
1034275052 7:149820330-149820352 GTGTCCACCCAGAGGATGGGTGG - Intergenic
1034411057 7:150942403-150942425 CTGGGAGCCCAGATGAGGGGAGG + Intergenic
1034443836 7:151101673-151101695 GTAGCAGTACAGAGGCTGGGAGG + Intronic
1034537016 7:151731701-151731723 GAGGAAACCCAGTGGATGGGAGG + Intronic
1035354825 7:158270694-158270716 GGGGCAGCCCAGTAGAGGGGTGG - Intronic
1036566822 8:9945004-9945026 GTGGCTGCCCGGAGGAGGTGGGG + Intergenic
1037549490 8:19956605-19956627 GGGGCCTCCCAGAGGGTGGGAGG - Intronic
1037785763 8:21902191-21902213 GTGGCAGCTCAGATGAAAGGAGG + Intergenic
1038553576 8:28490431-28490453 GTGGCGGCCAAGAGCGTGGGAGG + Intergenic
1041082674 8:54228188-54228210 GTGGCAGCCCAGGTGGTGAGAGG + Intergenic
1041748905 8:61237842-61237864 CAGGGAGCCCAGAGGATGTGTGG + Intronic
1042325807 8:67526618-67526640 ATGGTATCACAGAGGATGGGTGG + Intronic
1042591572 8:70402982-70403004 GTGTCAGCCCCGGGGGTGGGGGG - Intronic
1043530873 8:81148455-81148477 GTGCCAGACAAGAGGCTGGGTGG - Intergenic
1044582305 8:93834765-93834787 CTCACATCCCAGAGGATGGGCGG + Intergenic
1044749693 8:95404168-95404190 GAGGCAGCCCAGAGCAAGGTGGG - Intergenic
1045600198 8:103706613-103706635 GTAGCAGCCAAGAGGAAGTGAGG - Intronic
1047503295 8:125458913-125458935 GTGGGAACACAGAGGAGGGGAGG + Intergenic
1047715199 8:127588859-127588881 GTGGCAGTTAAGGGGATGGGAGG + Intergenic
1048206603 8:132420409-132420431 GTGGCAGCCCAGAAGGTGGATGG - Intronic
1049464615 8:142745075-142745097 GTGGATGGGCAGAGGATGGGTGG + Intergenic
1049546898 8:143236470-143236492 GAAGCAGCCCAGAGGAAGAGTGG - Intergenic
1050588928 9:7142442-7142464 GAGGGAGCCCAGGGGAGGGGAGG - Intergenic
1051257981 9:15233811-15233833 CTCACATCCCAGAGGATGGGCGG - Intronic
1051330698 9:16022415-16022437 GGTGCATCCCACAGGATGGGTGG - Intronic
1051513615 9:17906492-17906514 GTGTCAGCCCAGCGGAGGCGGGG - Intergenic
1052857914 9:33418440-33418462 GTGTCAGCCATGGGGATGGGTGG - Intergenic
1053470166 9:38340538-38340560 GTGGCAGACGAGAGCATGTGCGG - Intergenic
1054962096 9:70980307-70980329 GTGACAGCAGATAGGATGGGAGG + Intronic
1056097743 9:83272561-83272583 CTGACATCCCAGACGATGGGCGG - Intronic
1056217168 9:84416110-84416132 GTAGCAGCCCAGGGGAGGGGAGG - Intergenic
1056552063 9:87660182-87660204 GTGGAGGCCCAGGAGATGGGAGG + Intronic
1059118189 9:111617762-111617784 CTCGCATCCCAGACGATGGGCGG + Intergenic
1061249155 9:129416442-129416464 GTGACAGCACGGAGGAGGGGAGG - Intergenic
1061263253 9:129491424-129491446 GTGGCAGGCCCCAGGATGGAGGG + Intergenic
1061653001 9:132066176-132066198 GTGACTGCCCAGAGGCTGTGGGG + Intronic
1062002295 9:134222424-134222446 GTGGCAGCACAGAGGCTGGCAGG - Intergenic
1062019810 9:134313831-134313853 GTGCCAGCCTAGAGGAGGAGGGG - Intergenic
1062187856 9:135228137-135228159 GAGGCAGCCGTGAGCATGGGTGG + Intergenic
1062308331 9:135921928-135921950 GGGGCCGCCCAGAGGCTGTGAGG - Intergenic
1062357268 9:136170819-136170841 GTGGCTGACCAGAGGGTGGGCGG - Intergenic
1062441032 9:136569283-136569305 GGGGGAGCCCAGAGCATGTGGGG + Intergenic
1062450801 9:136614917-136614939 CAGGAAGCCCAGAGGAGGGGGGG + Intergenic
1062463825 9:136672603-136672625 CAGGCAGCCCGGAGGCTGGGTGG + Exonic
1062605316 9:137345190-137345212 GCGAGAGCCCAGAGGATGTGAGG - Intronic
1062631336 9:137464489-137464511 GTGGCAGCCCGCAGGGAGGGTGG - Intronic
1185580867 X:1210850-1210872 GTGGAAGACAAGTGGATGGGTGG + Intronic
1189129397 X:38482397-38482419 CTGGCAGCCCAAAGGAAGTGGGG - Intronic
1191028083 X:55937113-55937135 GAGGCACCCCAGAGTAGGGGTGG + Intergenic
1192362720 X:70449589-70449611 GTGGGAGGGCAGAGGAGGGGAGG + Intronic
1195178429 X:102333432-102333454 GTGGCAGCCCAGTGGAGAGCTGG - Intergenic
1195180435 X:102353651-102353673 GTGGCAGCCCAGTGGAGAGCTGG + Intergenic
1195257613 X:103104820-103104842 CTCACATCCCAGAGGATGGGTGG + Intergenic
1197186252 X:123590485-123590507 AAGGAAGCACAGAGGATGGGTGG - Intergenic
1198171500 X:134110138-134110160 GTGGCTGCCCAGGGGCTCGGGGG - Intergenic
1198783488 X:140261477-140261499 GTGCCTGCCCAGATTATGGGTGG + Intergenic
1200249897 X:154547231-154547253 GGGACAGCCCAGAGGAGGCGTGG - Exonic