ID: 914940120

View in Genome Browser
Species Human (GRCh38)
Location 1:152015045-152015067
Sequence AACACAGAGATGAGTAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 480}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914940116_914940120 9 Left 914940116 1:152015013-152015035 CCTCTGTGCTGGGCCCTTAGCTA No data
Right 914940120 1:152015045-152015067 AACACAGAGATGAGTAAAATAGG 0: 1
1: 0
2: 2
3: 45
4: 480
914940118_914940120 -5 Left 914940118 1:152015027-152015049 CCTTAGCTAAGAACCATGAACAC No data
Right 914940120 1:152015045-152015067 AACACAGAGATGAGTAAAATAGG 0: 1
1: 0
2: 2
3: 45
4: 480
914940115_914940120 10 Left 914940115 1:152015012-152015034 CCCTCTGTGCTGGGCCCTTAGCT No data
Right 914940120 1:152015045-152015067 AACACAGAGATGAGTAAAATAGG 0: 1
1: 0
2: 2
3: 45
4: 480
914940117_914940120 -4 Left 914940117 1:152015026-152015048 CCCTTAGCTAAGAACCATGAACA 0: 1
1: 0
2: 0
3: 21
4: 154
Right 914940120 1:152015045-152015067 AACACAGAGATGAGTAAAATAGG 0: 1
1: 0
2: 2
3: 45
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914940120 Original CRISPR AACACAGAGATGAGTAAAAT AGG Intergenic
903388648 1:22947512-22947534 GACACATAGTTCAGTAAAATAGG + Intergenic
903514930 1:23903805-23903827 AAAACAGAGATGATGATAATAGG - Intronic
903689254 1:25159673-25159695 AAAGCAGAGATGAGGAAAATTGG + Intergenic
904181261 1:28668529-28668551 CACTCATAGATGAGGAAAATAGG - Intergenic
904808796 1:33150167-33150189 AAGACAGAGATGAGGAAAAGTGG + Intronic
905605441 1:39294813-39294835 GACCCAGATGTGAGTAAAATGGG - Intronic
905698463 1:39993571-39993593 AACAAAGAAAAGAGGAAAATAGG - Intergenic
905938855 1:41846758-41846780 AAGACAAAGATGAATTAAATAGG - Intronic
906289133 1:44608523-44608545 ATCACACTGATGAGGAAAATGGG - Intronic
906906476 1:49899668-49899690 AAATCAGATTTGAGTAAAATGGG + Intronic
907613649 1:55900715-55900737 AACACAATGAAGAGAAAAATTGG - Intergenic
907679799 1:56552550-56552572 AATACTGAGATGAGTAAAACAGG + Intronic
908188389 1:61674963-61674985 AAGACAGAGATTAGCAGAATAGG + Intergenic
908972169 1:69849961-69849983 AACAAATAAATGAGTAAGATTGG + Intronic
909327405 1:74368363-74368385 CACACAGAAATGAATAACATTGG + Intronic
909559450 1:76993222-76993244 AACACAGAGATAGACAAAATAGG - Intronic
909661542 1:78088935-78088957 AAAACAGAAATTAATAAAATTGG - Intronic
909963522 1:81879183-81879205 AACATATAAATGAGTAGAATTGG + Intronic
910029254 1:82696967-82696989 AATACAGAGATGAGTAACTTTGG + Intergenic
910052388 1:82990575-82990597 AACAAAGATATGTATAAAATAGG + Intergenic
910254841 1:85237709-85237731 TACACAGAGATGAGTATCAGAGG + Intergenic
910741217 1:90519397-90519419 AAAACAGAAATCAATAAAATAGG + Intergenic
910742718 1:90537871-90537893 AACAAGGAGATCAGTAACATAGG + Intergenic
911379786 1:97098667-97098689 AGCTCAGAGAAGAGAAAAATGGG + Intronic
911868123 1:103054508-103054530 AACACAGATATGGTTAACATAGG - Intronic
912393252 1:109319509-109319531 AAAAAATAAATGAGTAAAATAGG - Intronic
913088058 1:115457374-115457396 GACACAGAGATGAGTGAACATGG + Intergenic
913130262 1:115832687-115832709 AACACAGAGATGGGAGAAACAGG + Intergenic
914928274 1:151907653-151907675 AACAGAAGGATGAGTGAAATGGG + Intronic
914940120 1:152015045-152015067 AACACAGAGATGAGTAAAATAGG + Intergenic
915740327 1:158113988-158114010 GATACAGGGATGACTAAAATAGG + Intergenic
916335959 1:163671518-163671540 AGCATAGAGGTGAGTAAACTGGG + Intergenic
916449358 1:164905064-164905086 AACACCAAGTTAAGTAAAATAGG + Intergenic
917199924 1:172503798-172503820 AATACAGAGGTGAGGGAAATCGG + Intergenic
917386533 1:174482312-174482334 GACAAAGGGATAAGTAAAATAGG + Intronic
917596547 1:176534969-176534991 AACACAGGGAAGAGTAATTTTGG - Intronic
917892047 1:179449366-179449388 AACATACACATGAGTAGAATAGG - Intronic
918091732 1:181301352-181301374 AAAACAGACATGAGAAAACTAGG - Intergenic
918105985 1:181415643-181415665 AACACAGAGATGACCTGAATGGG + Intronic
918950188 1:191126375-191126397 AACACTGAGAAGGGTGAAATGGG + Intergenic
919325934 1:196107540-196107562 AAAAGAGAGAAGAATAAAATAGG + Intergenic
919401910 1:197129057-197129079 AATACTCAGAGGAGTAAAATAGG - Intronic
919417586 1:197330764-197330786 AACATAGATATATGTAAAATAGG - Intronic
921721973 1:218482537-218482559 AACACAGAGAGGAGGAAGAGTGG + Intergenic
924252703 1:242150845-242150867 AACAAATAGATGAGGAAAAATGG - Intronic
924747937 1:246855253-246855275 TATACAGAGATGAGGAAGATAGG - Intronic
1063145594 10:3292484-3292506 AATTCAGAGATGAGGAAACTGGG + Intergenic
1063800315 10:9569725-9569747 AACAAAGAAATAAGAAAAATAGG - Intergenic
1065643469 10:27809162-27809184 AACACACAGATGAGCAAAAGAGG + Intergenic
1068517569 10:58043438-58043460 AAGGCAGAATTGAGTAAAATAGG - Intergenic
1071350782 10:84741739-84741761 AAGACAGAGATCATTAGAATGGG - Intergenic
1071406997 10:85345674-85345696 AACACACAAAAGAGTAAAGTCGG + Intergenic
1071411470 10:85401059-85401081 AATACAGAGATGAGTGATGTTGG - Intergenic
1071443162 10:85721857-85721879 CACAGAGAGATGAGTACAAGAGG + Intronic
1071740527 10:88353071-88353093 AAAACAGAGAAGAATCAAATAGG - Intronic
1071780738 10:88841480-88841502 AACTCAGAGTTGAGCAAAATTGG + Intronic
1071970928 10:90906086-90906108 AATACAGAAATGAGTAACAAAGG - Intronic
1071989790 10:91090314-91090336 ATAACAGAGACAAGTAAAATTGG + Intergenic
1072046316 10:91659434-91659456 AAAATATAAATGAGTAAAATTGG - Intergenic
1073349761 10:102811259-102811281 CACACAGAAATAAGCAAAATGGG - Intronic
1074269384 10:111938092-111938114 AAAACTGATATGAGTAAGATGGG + Intergenic
1075354058 10:121755123-121755145 AACAGAGAGAAAAGTAACATAGG + Intronic
1077203535 11:1327197-1327219 AGCACAGGGATGTGTAACATAGG + Intergenic
1078349694 11:10582272-10582294 AGCGCTGAGATGAGGAAAATGGG + Intronic
1079572810 11:21965621-21965643 TGCACAGAGATGAGTAAGAGAGG - Intergenic
1079576866 11:22014975-22014997 ATCACATGGATGATTAAAATAGG + Intergenic
1079863744 11:25708413-25708435 AAAGCAGAGATGAGCATAATGGG + Intergenic
1080417863 11:32086389-32086411 AACACAGCGAGGAGAATAATCGG - Intronic
1080775629 11:35383741-35383763 AATACAGAGATGAGAAAGACAGG - Intronic
1080853886 11:36094835-36094857 AAATCAGAAATGACTAAAATGGG - Intronic
1081074844 11:38658844-38658866 AATATAGAGAGGATTAAAATTGG - Intergenic
1081126123 11:39324748-39324770 ATCAAAGAGATGAGAAAAAGAGG - Intergenic
1081148621 11:39598011-39598033 AACATAAAAATGAGGAAAATAGG - Intergenic
1081283296 11:41237798-41237820 AACACAGAGAAGTGATAAATAGG - Intronic
1082109242 11:48255921-48255943 AAAAAAAAGATGAGAAAAATGGG + Intergenic
1082223987 11:49678967-49678989 AACACAAAGAAAATTAAAATTGG + Intergenic
1085556940 11:77432036-77432058 AGGACACAGATGAGTAAGATGGG - Intronic
1086040833 11:82476410-82476432 AAGACAAAAATCAGTAAAATAGG - Intergenic
1086273685 11:85098129-85098151 ATCACAGAGATGACTCAAAGAGG + Intronic
1086625052 11:88940202-88940224 AACACAAAGAAAATTAAAATTGG - Intronic
1086987435 11:93265843-93265865 TACACAGAGATGACTCCAATTGG + Intergenic
1087540979 11:99519372-99519394 CACACTCAAATGAGTAAAATTGG - Intronic
1087810423 11:102604252-102604274 AGCACAGATCTGAGTAAACTTGG - Intronic
1087930554 11:103973005-103973027 AATACAGAAATGAGTAATACAGG + Intronic
1088074548 11:105830774-105830796 GCCACAGAGATGAGTCAAACAGG - Intronic
1088211642 11:107463388-107463410 AAAACAGAGAAGAATCAAATAGG - Intergenic
1088531094 11:110810476-110810498 AACACAGCAGTGAGCAAAATAGG - Intergenic
1088965458 11:114716467-114716489 AAGACAGAGATGAGTAAGGGAGG - Intergenic
1089080783 11:115774612-115774634 ATCAGAGAGATAGGTAAAATAGG + Intergenic
1090557745 11:127895002-127895024 TAAAGAGAGATTAGTAAAATGGG - Intergenic
1090749670 11:129734570-129734592 AATACAGAGATCAGGAAAAGTGG - Intergenic
1092648798 12:10610547-10610569 AACACAGACTTGAAGAAAATGGG + Intronic
1093163701 12:15780747-15780769 AATACAAAGATGAGTAAGACAGG - Intronic
1093308576 12:17549321-17549343 CACATACAGAGGAGTAAAATTGG - Intergenic
1093424181 12:19009710-19009732 AACCCAGAGATAGGAAAAATGGG + Intergenic
1093676250 12:21943119-21943141 ATCACAGATATTAGTAAAATTGG - Intergenic
1093991988 12:25600097-25600119 GACACATAGATGAATGAAATAGG + Intronic
1094678729 12:32648478-32648500 AAAACAGAACTGAGTAAACTGGG - Intergenic
1095469036 12:42517198-42517220 CCCACAAAGATGAATAAAATGGG - Intronic
1095895067 12:47271660-47271682 AACACTGAGATGCTTGAAATGGG + Intergenic
1098297327 12:69017296-69017318 AACACAGAAATGTGTAAAGAAGG + Intergenic
1099060921 12:77907304-77907326 TCCACATAGATGAATAAAATTGG - Intronic
1099159882 12:79227964-79227986 AACACAGAGATCATTGGAATGGG - Intronic
1099970836 12:89498987-89499009 AGCAGAGAGGTGAGTGAAATAGG + Intronic
1100694732 12:97079997-97080019 AACACAGTGATTAAGAAAATGGG - Intergenic
1101268846 12:103121467-103121489 AACACGGAGATGAATCAAATTGG + Intergenic
1101717560 12:107323780-107323802 GACACAGAGATGAATAAGAATGG - Intronic
1102151991 12:110695012-110695034 AACACAGAGTTGAGTAAGACAGG + Intronic
1102834517 12:116042022-116042044 AATACAGTGCTGAGTAAAATAGG - Intronic
1105055374 12:133094005-133094027 AACAGAGAGAAAAGTAAAACTGG - Intronic
1105244722 13:18639002-18639024 AATACAAGGATGAGCAAAATTGG + Intergenic
1107347648 13:39479514-39479536 AATAAAGAGAAGAATAAAATAGG + Intronic
1107401597 13:40074622-40074644 ACCACAGAGATTAGTAAAGAAGG - Intergenic
1109564528 13:64094958-64094980 AATACAGCAATGAATAAAATTGG + Intergenic
1109600525 13:64621917-64621939 AACAAACGGATGAGTAAACTAGG - Intergenic
1109995513 13:70119441-70119463 AACCCAGAGCAGAGGAAAATGGG - Intergenic
1110128412 13:71977385-71977407 ATCCCAGAGATGAGGAAGATAGG + Intergenic
1110262420 13:73500526-73500548 AACACAGAGATGAACACGATAGG - Intergenic
1110422675 13:75331022-75331044 AACACCACTATGAGTAAAATAGG - Intronic
1110448777 13:75617921-75617943 AACAGAGGGAAGAGTAAAAGGGG - Intergenic
1110548212 13:76780723-76780745 AACACAGAGAGGATTAACCTTGG - Intergenic
1110812438 13:79825762-79825784 AATATAAAGATGAGTAAAAGAGG + Intergenic
1110821541 13:79923109-79923131 AACAGAGAGAAGAATCAAATAGG - Intergenic
1111182764 13:84690197-84690219 AACAGAAAGATAAGTAAACTTGG + Intergenic
1111788749 13:92825845-92825867 AACACAGCATTGAGTAAAAAGGG - Intronic
1112090028 13:96073242-96073264 GACACAGAAATGAGTAGAACAGG - Intergenic
1112888182 13:104199386-104199408 AAAACACAGATTAGTCAAATTGG + Intergenic
1113095427 13:106658683-106658705 AACACAGCAATGAGCAAAACAGG - Intergenic
1113183953 13:107664616-107664638 AACTTGGAGATGAGTAGAATAGG - Intronic
1113306647 13:109086507-109086529 AAAACAGTCATGATTAAAATTGG - Intronic
1113377536 13:109779591-109779613 AACACAGAGAACAGCAGAATAGG - Intronic
1114071870 14:19116847-19116869 ATCACAGAGATAGGGAAAATGGG + Intergenic
1114090388 14:19283117-19283139 ATCACAGAGATAGGGAAAATGGG - Intergenic
1114580118 14:23749426-23749448 AAAACAGAGAGGAGTAAAGGAGG + Intergenic
1115442910 14:33456725-33456747 CACACAGAGATCAGTAGAGTTGG - Intronic
1116022571 14:39479186-39479208 AAAAGAGAGAAGAGTCAAATAGG - Intergenic
1116507650 14:45704424-45704446 AAGACAGACATGAGTAGACTTGG + Intergenic
1116888846 14:50247695-50247717 AACACAAAAATAAGTAGAATAGG - Intronic
1119012297 14:71005753-71005775 AACAGGAAGATGAGTAAAACTGG - Intronic
1119368180 14:74113430-74113452 AACACAAAGATGGGTAGAAATGG + Intronic
1122757710 14:103995921-103995943 AACACAGAATTGAGAAAAGTAGG + Intronic
1123217470 14:106824581-106824603 AACACAGTGATGAGGAACACGGG - Intergenic
1124789225 15:32711041-32711063 AACACACATATGAGGAATATGGG - Intergenic
1126442792 15:48709635-48709657 AAAAAAGAGAAGAGTTAAATAGG - Intergenic
1127132041 15:55876584-55876606 AGCACAGAGAAGAGTTAAAATGG + Intronic
1127141168 15:55979084-55979106 AACTCAGAGATAAGTAAAAATGG - Intronic
1128039638 15:64559936-64559958 AACAGAGAAGGGAGTAAAATAGG + Intronic
1128179579 15:65589968-65589990 TACAGAGAGAAGAGTAAATTTGG - Intronic
1128679659 15:69638928-69638950 AACATAGAGATGTTTATAATAGG - Intergenic
1128726216 15:69990406-69990428 AACACAGTAATGATTTAAATTGG - Intergenic
1128774197 15:70307215-70307237 AACACAGGAGTGAGGAAAATTGG + Intergenic
1128777354 15:70331589-70331611 AGCACAGTGATGAATAAAAGTGG + Intergenic
1128795333 15:70462552-70462574 ATTTCAGAGATGAGGAAAATGGG + Intergenic
1128957204 15:71960825-71960847 AAGCCAGAGATGAGAAAACTGGG + Intronic
1129585976 15:76865454-76865476 AACAGAATGATGAGAAAAATGGG + Intronic
1131824025 15:96302830-96302852 AGCATATAGATGAGAAAAATGGG + Intergenic
1132257477 15:100388947-100388969 AAAATATAGATGAGCAAAATTGG + Intergenic
1133588512 16:7219236-7219258 ACCACAGGGAAAAGTAAAATGGG + Intronic
1134759965 16:16705584-16705606 AACACAGAGATGAATGCAGTTGG + Intergenic
1134986106 16:18653621-18653643 AACACAGAGATGAATGCAGTTGG - Intergenic
1135473160 16:22750271-22750293 AACACAAAAATGAGTGAAGTGGG + Intergenic
1135473418 16:22752313-22752335 AAGACAGACATGAATAACATTGG + Intergenic
1137538298 16:49344108-49344130 AGCAAATAGATGAGTAAACTAGG - Intergenic
1138759452 16:59523906-59523928 TACACAGAGCTCAGTAAAACAGG - Intergenic
1138986991 16:62341642-62341664 AATAGAGAGATGAGTAAAAGTGG - Intergenic
1139533931 16:67560144-67560166 AAAAAAGAAATGAGAAAAATTGG + Intergenic
1139784583 16:69382038-69382060 AAAGCAAGGATGAGTAAAATGGG - Intronic
1140769687 16:78191931-78191953 CACACAGAGAACACTAAAATTGG + Intronic
1140804706 16:78522482-78522504 AAGACAGAGAAGAGTGACATCGG - Intronic
1140894470 16:79313015-79313037 AACTCAGAGAAGAGTAGACTGGG + Intergenic
1141008096 16:80372026-80372048 AAAACACAGAGGAGGAAAATGGG - Intergenic
1141282523 16:82641778-82641800 AATACAGAAATGAGTAAGACAGG + Intronic
1141491380 16:84376154-84376176 AACACAGAGATAAGTAGTTTGGG + Intronic
1142950840 17:3478787-3478809 ACCACTGAGATGAGGAATATAGG - Intronic
1144561354 17:16322839-16322861 ACCACAAAAATGAGAAAAATGGG - Intronic
1145915085 17:28568694-28568716 AACACAGTGTTCAGTAATATGGG - Intronic
1147516472 17:41122607-41122629 GACACAAAGATGAGAACAATTGG + Intergenic
1148376167 17:47148380-47148402 AACACGGAGAGGAGAAAGATTGG + Intronic
1148408262 17:47439991-47440013 AACACATGTATGAGTAATATTGG + Intronic
1148635070 17:49142829-49142851 AACATATAAATGAATAAAATAGG - Intronic
1149015999 17:51908923-51908945 CACAAAGACATTAGTAAAATAGG + Intronic
1149192880 17:54085292-54085314 TCCACAGAGATCAGGAAAATGGG - Intergenic
1149441381 17:56677394-56677416 AACATAAAGATGATTAAAATTGG - Intergenic
1149789956 17:59468178-59468200 AACAAAGAGAAGAGTAGCATGGG - Intergenic
1150530159 17:65972530-65972552 AAAACAGAGATCAATAAAATGGG + Intronic
1151057270 17:71048083-71048105 AACACTGAGATGAATCAAAAGGG + Intergenic
1151371655 17:73650451-73650473 AAGACATTCATGAGTAAAATGGG - Intergenic
1152915020 17:83030036-83030058 ATCACAGAGACAAGTAAAACGGG + Intronic
1153371436 18:4321069-4321091 AACTAAGAGATGAGAAAAAGGGG - Intronic
1154444217 18:14420890-14420912 AATACAAGGATGAGCAAAATTGG - Intergenic
1155745475 18:29351777-29351799 TACACAAAAATGAGAAAAATCGG + Intergenic
1156530447 18:37809997-37810019 AACACAGAAAGGAGAAAAATAGG - Intergenic
1157204676 18:45688061-45688083 TACACACAGATGAGCAGAATAGG - Intergenic
1157295618 18:46440135-46440157 AGAACAAAGATGAGTAAAACTGG - Intronic
1157307190 18:46525808-46525830 AATCCAGAGATGAATAGAATAGG + Intronic
1157771511 18:50351459-50351481 AACACAGATATGAAAAAAGTGGG + Intergenic
1158008221 18:52697976-52697998 TTCACAGAGCTGAGTAAGATAGG - Intronic
1158164258 18:54521238-54521260 AACAAAGTGATTACTAAAATAGG - Intergenic
1158396735 18:57084931-57084953 AACAGAGAGAGGAGTAAATGAGG + Intergenic
1158597604 18:58829814-58829836 AACACATGGATAAGTAAAATGGG - Intergenic
1159284072 18:66326806-66326828 AACCCACATATGAGTAATATGGG + Intergenic
1159412037 18:68090697-68090719 AGAACAGAAATCAGTAAAATTGG + Intergenic
1159491359 18:69139311-69139333 GATACAGAGATGCATAAAATAGG + Intergenic
1159696904 18:71571320-71571342 ATTTCACAGATGAGTAAAATTGG - Intergenic
1159832885 18:73299185-73299207 AACACAGAGATGATCAACAAAGG + Intergenic
1161125333 19:2553019-2553041 GAGACAGAGATGAGAAAAACTGG + Intronic
1163077263 19:14905082-14905104 AACAAAGAGATGCATGAAATAGG + Intergenic
1163904776 19:20142912-20142934 AACACAAAGAGGAGAAAAACAGG + Intergenic
1164455594 19:28404075-28404097 AACACAGAGGTGAGGAAGAGAGG - Intergenic
1167450907 19:49568642-49568664 AATAGAAAGATGAGTAAAAGAGG + Intronic
925198849 2:1950161-1950183 ATCACAGAGCTGAGTAACAGTGG + Intronic
925221910 2:2148536-2148558 AGGAAAGAGATGAGTATAATAGG + Intronic
925255187 2:2478100-2478122 AACACAAAGTTGAATAAAATTGG + Intergenic
926080478 2:9981803-9981825 GACACAGAGATGATTAAGACAGG + Intronic
926411959 2:12613812-12613834 AAGAGAGAGAAGAGAAAAATAGG - Intergenic
927345244 2:22030977-22030999 ATAACAGAGATGAGAAAAAATGG + Intergenic
928402144 2:30986790-30986812 ATCACAAAGATGAATAAAATGGG - Intronic
928713482 2:34033873-34033895 AAGACAGAGAGAAGTAAACTCGG + Intergenic
928923542 2:36552374-36552396 CACACAGGCATGAATAAAATAGG + Exonic
929836533 2:45406140-45406162 GACACAGAGATCAATACAATGGG + Intronic
930093574 2:47549581-47549603 AACATAATGATGAGAAAAATGGG + Intronic
930477792 2:51905851-51905873 AAGACAGAGATAAGCAGAATGGG + Intergenic
931054788 2:58457246-58457268 AACACAGAGTTGAGAAGAGTTGG + Intergenic
931186179 2:59953521-59953543 AAGAAAGAGATGAGGAAAAGAGG + Intergenic
931706459 2:64950604-64950626 AGGACAGAGATGATTAAAACAGG + Intergenic
931759532 2:65404602-65404624 AAGACAGCAATGAGTAAAACAGG + Intronic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932882799 2:75519330-75519352 GTCACAGATATGAGTAACATGGG + Intronic
934229726 2:90168560-90168582 AAGACAGAGATCAGTGAAAGAGG + Intergenic
935218681 2:100993952-100993974 AATACAGTGATGTGTGAAATTGG + Intronic
935953040 2:108348289-108348311 TGCACAGAGATGAGAAAACTAGG - Intergenic
938486117 2:131710299-131710321 ATCACAGAGATAGGGAAAATGGG + Intergenic
939099915 2:137883972-137883994 AATACAAGGATGAGCAAAATTGG + Intergenic
939329409 2:140738046-140738068 AACCCAGAGATCAGTAGAGTTGG + Intronic
939613890 2:144340932-144340954 AACACAGAGGTGAGGAAAGGGGG - Intergenic
939742952 2:145932913-145932935 AACACATAGAAGAATAAAATAGG + Intergenic
940249441 2:151658535-151658557 AACAAAGAAATGATAAAAATAGG + Intronic
940349855 2:152670841-152670863 AAAAGAGACATGAGTAAAATAGG + Intronic
940410583 2:153359444-153359466 AACACAAAATTGAGTAAAACAGG + Intergenic
940979458 2:159985178-159985200 ACCTTAGAGATGAGTAAACTGGG - Intronic
941035880 2:160568840-160568862 AAAAAAGAGATGAGTGAAAACGG - Intergenic
941293972 2:163713166-163713188 AAAACAGAGATTTGCAAAATTGG - Intronic
941538811 2:166756992-166757014 TACACACATATGAGTCAAATTGG - Intergenic
941665658 2:168241841-168241863 AACATAGGGATGATAAAAATAGG - Intronic
941701587 2:168609644-168609666 AACACAGAGCAGGGAAAAATGGG - Intronic
942201056 2:173571784-173571806 ATCAAAGACATGAATAAAATCGG + Intergenic
942213548 2:173695531-173695553 AACACAGAGATTAGCAAGAAAGG - Intergenic
942848287 2:180452975-180452997 AATACAGAGCTGAGTTAAAATGG + Intergenic
943122062 2:183748892-183748914 AGAACAGAGATGATTGAAATTGG + Intergenic
943536486 2:189157929-189157951 AAAACACAGATGTGTAGAATGGG - Intronic
943879088 2:193115637-193115659 AAAACAGAAATCAGTGAAATTGG + Intergenic
944020332 2:195094977-195094999 CAGACAGAGAAGACTAAAATAGG + Intergenic
944333359 2:198499572-198499594 AATACAGAGAAGAGATAAATGGG - Intronic
944500926 2:200359511-200359533 AAGACAGAGAAGAGTCAAAGTGG - Intronic
944906278 2:204265126-204265148 AACATAGAGGTTAATAAAATGGG - Intergenic
944985556 2:205171630-205171652 AACACAGAGGTGTGTAGAAAAGG - Intronic
945824519 2:214704552-214704574 AAAACAGTGATGAGAAAACTGGG + Intergenic
946704801 2:222447792-222447814 AATACAGTGGTGAGTAAAACAGG + Intronic
946960015 2:224974992-224975014 AACACAGTGATAAAGAAAATCGG - Intronic
948154842 2:235772955-235772977 AACACAGAGGGGAGAAAAAGTGG - Intronic
948428374 2:237902480-237902502 AACACAGCGAGGAGGAAAGTGGG + Intronic
948773443 2:240265464-240265486 GACACAAAGATGAGAACAATAGG - Intergenic
1168935145 20:1658510-1658532 AACTCAGTGATGAATGAAATAGG - Intergenic
1168948583 20:1781281-1781303 ACCACAGAGATGAGTCAGACAGG + Intergenic
1169009911 20:2241951-2241973 GATACAGAGTTGACTAAAATAGG + Intergenic
1169763482 20:9122694-9122716 AACACTGAGGCAAGTAAAATTGG - Intronic
1169917008 20:10693192-10693214 AACACAGATATGATTTAAATGGG - Intergenic
1170187407 20:13606303-13606325 AACAGAGACATGAATGAAATGGG - Intronic
1170381916 20:15770465-15770487 GAGTCAGAGATGAGTAAAAATGG - Intronic
1171248267 20:23630450-23630472 AACACAATGGTGACTAAAATAGG - Intronic
1172267545 20:33629836-33629858 AACACAGAGCTGAGGAAAACGGG + Exonic
1174364231 20:50046821-50046843 CACACACAGATGAGGAAACTGGG + Intergenic
1176451766 21:6868971-6868993 AATACAAGGATGAGCAAAATTGG + Intergenic
1176829938 21:13734022-13734044 AATACAAGGATGAGCAAAATTGG + Intergenic
1178027794 21:28488021-28488043 AATAAGGAGATGAGTAAACTTGG + Intergenic
1178244696 21:30939078-30939100 AACCTAGAAAAGAGTAAAATAGG - Intergenic
1178326416 21:31649170-31649192 AACACAGAAATCAGTGAAAGAGG + Intergenic
1178606867 21:34045212-34045234 AAAACAGTGAGAAGTAAAATGGG - Intergenic
1178713348 21:34940552-34940574 AACCCAGAGATGAATTAAAAAGG + Intronic
1178880974 21:36449897-36449919 AGCACAGAGATGAGGGCAATGGG - Intergenic
1180490311 22:15839202-15839224 ATCACAGAGATAGGGAAAATGGG + Intergenic
1180580300 22:16829362-16829384 AATACAGTTAGGAGTAAAATGGG + Intergenic
1181465111 22:23106776-23106798 ACCACACAGATGAGGAAACTCGG + Intronic
1182160949 22:28120999-28121021 AACACTGAAAGGAGCAAAATGGG + Intronic
1182858475 22:33538610-33538632 AATACAGAGATAAATAAAACAGG + Intronic
1183369596 22:37425061-37425083 AACACAGAAAGCAGCAAAATGGG + Intronic
1185311876 22:50160658-50160680 CACACAGAGATGAATAAAAATGG - Intronic
1185408362 22:50670420-50670442 AAAACAGAGATGATCAAAAAAGG + Intergenic
949309300 3:2678466-2678488 AACACAAAGATAACTAAAAGGGG - Intronic
949927332 3:9052011-9052033 AACACAGAACTGAGCAAAATTGG - Intronic
950495489 3:13331609-13331631 AACACAGATATGGGTGACATAGG - Intronic
950738284 3:15029078-15029100 AAAATATAGATGAGAAAAATAGG - Intronic
951274568 3:20669813-20669835 AACACAGATATAAATATAATGGG - Intergenic
951445458 3:22774632-22774654 AAAATAGAGAAGAGTAAAACTGG - Intergenic
951701451 3:25501351-25501373 ATCACAGAGATAAGGAAAACAGG - Intronic
952115294 3:30171920-30171942 AACACAGAGCTGTGAAAATTGGG - Intergenic
953222704 3:40987564-40987586 AACTCAAATATGAGGAAAATAGG - Intergenic
953575787 3:44112222-44112244 AGCACAGAGAGGAGGAGAATAGG + Intergenic
954648382 3:52145042-52145064 AAAACAGAGATGAGCAAGACTGG - Intronic
955087183 3:55714341-55714363 AACACAGGGATGAATACAAAAGG + Intronic
955155982 3:56417067-56417089 TAGACTGAGATGAGCAAAATAGG + Intronic
955423275 3:58761406-58761428 AAAACAGAGAAGAATCAAATAGG - Intronic
955438874 3:58934042-58934064 AAAACAGAGAAGAATCAAATAGG + Intronic
955564717 3:60231744-60231766 AGCACATTGATGTGTAAAATTGG + Intronic
956493321 3:69797568-69797590 AAAACAGAAAAGAGTGAAATGGG - Intronic
956925451 3:73982288-73982310 AACACAGTGATGTGATAAATGGG - Intergenic
957015473 3:75059038-75059060 AAGACACATAAGAGTAAAATGGG - Intergenic
957132936 3:76245296-76245318 AACACAGCAGTGACTAAAATAGG - Intronic
959105851 3:102063653-102063675 AACACAGAGGTGAGCAAACCCGG + Intergenic
959413093 3:106049191-106049213 AACACAAAAATGTGGAAAATAGG + Intergenic
959799763 3:110478641-110478663 ACAAAAGAGATGAGAAAAATAGG - Intergenic
960380800 3:116959056-116959078 AATACAAAGAGGAGTAAGATAGG + Intronic
960397324 3:117153324-117153346 AACACAGAGAAGAGAAAATCTGG - Intergenic
960717636 3:120593481-120593503 AAAACAGAGATGAGTACAAAAGG - Intergenic
960945573 3:122964136-122964158 ATGACAGAGATGAGGAACATGGG - Intronic
961197166 3:125012419-125012441 AACACAGGGGTGAGAAAATTAGG + Intronic
961686158 3:128632911-128632933 ACCACATAGAAGAGTGAAATCGG - Intronic
962669721 3:137692835-137692857 AACACAGTGTGGACTAAAATGGG - Intergenic
962949070 3:140201321-140201343 GACACAGAGGGGAGAAAAATGGG + Intronic
963633957 3:147769817-147769839 AAAACAGAGAGGAGTAAATATGG + Intergenic
964373267 3:156023798-156023820 AACACAAAGATGAGCAATTTGGG - Intergenic
965559018 3:170044334-170044356 AAAAAAGAGAAGAGAAAAATGGG + Intronic
965922686 3:173938076-173938098 AATACAAAGATGATTAAAAGAGG + Intronic
966464742 3:180217867-180217889 AAAACAGAAATCAATAAAATTGG + Intergenic
968051334 3:195657188-195657210 AACCCAAATATCAGTAAAATGGG + Intergenic
968595525 4:1480354-1480376 AACACAAAGATGATAAAACTAGG - Intergenic
971415524 4:26424462-26424484 CTCACAGAGATGAATAAAAAAGG - Exonic
972593908 4:40513677-40513699 AACACAGAGTTGAGGATAAGAGG + Intronic
972610743 4:40653336-40653358 AACGCACAGAGGAGGAAAATAGG - Intergenic
972941110 4:44196615-44196637 AGAACAGAGAAGAGTAAAACTGG + Intronic
973164444 4:47059219-47059241 AACACATAGGTAAGTAAAACTGG - Intronic
974383373 4:61171934-61171956 AACAATGAAATGAGAAAAATGGG + Intergenic
974394833 4:61321369-61321391 AACTTACAGATGAGAAAAATGGG - Intronic
974407074 4:61486887-61486909 AATACATGCATGAGTAAAATGGG + Intronic
975636275 4:76452508-76452530 AACACTGTGCTAAGTAAAATAGG - Intronic
975786882 4:77899808-77899830 AACACAGAGAAAAGTGAAAGTGG + Intronic
975840471 4:78468664-78468686 AACAAAGGGATGAGTAAAAATGG - Intronic
975851356 4:78576025-78576047 ATAACAGAGAAGAGAAAAATAGG - Intronic
976523522 4:86058621-86058643 AACACAGAGATAAGCAAAAATGG - Intronic
977253365 4:94713185-94713207 AACACAGAAATTAGTAAGAATGG - Intergenic
977411605 4:96673115-96673137 AACACATATATGTGTAAAAGTGG - Intergenic
978023126 4:103838719-103838741 AACACAGAGATGAATAAGATAGG + Intergenic
978048590 4:104166635-104166657 TACACAGAGAACATTAAAATTGG - Intergenic
978488802 4:109287973-109287995 AACACATGCATGAGTAAGATGGG + Intronic
978516949 4:109578799-109578821 AAAAGAGAGAGGAGAAAAATAGG - Intronic
978712240 4:111798198-111798220 TACACAGAGATATGGAAAATTGG + Intergenic
978942624 4:114455296-114455318 AGCACAGAAATGAGAAAAAGAGG + Intergenic
979162771 4:117484838-117484860 AAGAGAGAGATGTGTAAACTAGG + Intergenic
979584067 4:122394114-122394136 ATCTCATAGATGAGTAAAAAAGG - Intronic
979902283 4:126236734-126236756 AACTTAGAGAGAAGTAAAATTGG - Intergenic
980236736 4:130117395-130117417 AAAACAGTGAGGATTAAAATTGG - Intergenic
980629246 4:135411853-135411875 AAGACAATCATGAGTAAAATTGG - Intergenic
980956861 4:139437784-139437806 AAGACAGAGATTAGAAGAATGGG - Intergenic
981191182 4:141865398-141865420 AAAATAGAGAAGATTAAAATAGG - Intergenic
981300486 4:143180624-143180646 GACACATAGATCAGTGAAATGGG - Intergenic
982202348 4:152973119-152973141 AACCCAGAGATGACTGGAATTGG - Intronic
983077298 4:163342569-163342591 AACACACAGAAGAATAAAACAGG + Intronic
983720414 4:170844704-170844726 TACACATAGAAGAGTAAATTAGG - Intergenic
984172385 4:176375369-176375391 AACATACAGATGAGTATAACAGG + Intergenic
985387335 4:189461552-189461574 AACACTGAGATGGTAAAAATGGG + Intergenic
986280918 5:6321691-6321713 ATCACAGAGAAAATTAAAATGGG + Intergenic
986780580 5:11061668-11061690 ACTTCAGACATGAGTAAAATAGG - Intronic
986862733 5:11947108-11947130 AACATGGAAATAAGTAAAATTGG + Intergenic
986976232 5:13397580-13397602 AACACAGAAATGCGGAAAAACGG + Intergenic
987020270 5:13863455-13863477 ACCACAGAGATGGGGAACATGGG - Intronic
987800454 5:22689487-22689509 AAAATAAAAATGAGTAAAATTGG + Intronic
988133903 5:27143416-27143438 AATCCAGAGATGGGTAAAAGAGG + Intergenic
988193247 5:27965962-27965984 AGCACAGAGTTGAGGAAATTAGG - Intergenic
988681346 5:33487282-33487304 GACACAGTGAAGAGGAAAATTGG - Intergenic
988979659 5:36553982-36554004 AACAGGGAGATAAGTGAAATTGG - Intergenic
989360517 5:40596540-40596562 AATATAGAGATGAGTGAAGTAGG + Intergenic
989548227 5:42699345-42699367 AACACAGAAATGAGGTAAACAGG + Intronic
989771408 5:45150997-45151019 GAAACAGGCATGAGTAAAATGGG - Intergenic
990049500 5:51480038-51480060 GAGAGAGATATGAGTAAAATGGG + Intergenic
990235383 5:53761798-53761820 AGCACAGAGATGGGTAGAAAGGG + Intergenic
990980177 5:61595297-61595319 CACACATACATGAATAAAATGGG - Intergenic
993859415 5:93116676-93116698 TACACATAGAAGAGGAAAATTGG + Intergenic
994995804 5:107061444-107061466 AAAAAAGAGCTAAGTAAAATAGG + Intergenic
995134841 5:108670131-108670153 TACACCGAGGTGAGTAAAAGTGG + Intergenic
995259407 5:110084185-110084207 AAAACAGAGTTGTGTAAAAGAGG - Intergenic
995285505 5:110383975-110383997 AAAAAAAAGATGAGGAAAATGGG + Intronic
995290423 5:110444903-110444925 AAGACAAAGAGGAGGAAAATGGG - Intronic
996668231 5:126085815-126085837 GACACAAAGATGAGTAGAATAGG + Intergenic
996984405 5:129541692-129541714 ACAACAGAGATAAATAAAATAGG - Intronic
997915592 5:137921484-137921506 AGTACAGAGTTGTGTAAAATTGG - Intronic
998632273 5:143912412-143912434 ATCTCAGAGAAGAGTAAATTTGG - Intergenic
999512095 5:152262981-152263003 AAAGCCGAGATGAGAAAAATAGG - Intergenic
999706287 5:154275214-154275236 GATACAGAGATGAATAAAAATGG + Intronic
1000728698 5:164803772-164803794 AACACAAAGAAGAGGCAAATGGG - Intergenic
1000758551 5:165191718-165191740 GACACTGAGATGATTAAAAAAGG - Intergenic
1000934933 5:167296103-167296125 AACACAGAGAAAAGTCAGATGGG + Intronic
1000964127 5:167634827-167634849 ATCATAGAGATGAGTGGAATTGG + Intronic
1001701453 5:173709571-173709593 AATACATAGATGAGCAAAACAGG - Intergenic
1002715479 5:181224160-181224182 AGGACAGAGATGAGTTAGATCGG + Exonic
1003152094 6:3561382-3561404 AACTCACAGATGAGCAAAAAAGG + Intergenic
1003622118 6:7709628-7709650 AACACAGATATGAATACATTTGG - Intergenic
1003663143 6:8083621-8083643 AACTCAGCCATGACTAAAATTGG + Intronic
1005319072 6:24634172-24634194 AATACAGAGATGAATAAAGCAGG + Intronic
1006545056 6:34773802-34773824 AACACAGAGAGGAGGAAAAAGGG - Intergenic
1006966840 6:37995641-37995663 AATACAAAGATGAGTAAAGCAGG + Intronic
1007562534 6:42822198-42822220 AACAGAGACATGATTAACATAGG + Intronic
1008315904 6:50040289-50040311 AACATAGAGATGAAAAAAATAGG - Intergenic
1008380247 6:50833134-50833156 AACCCAGAGATGACTGAGATAGG - Intronic
1008780507 6:55098016-55098038 AAGAAAGATATGAATAAAATAGG - Intergenic
1008816169 6:55569337-55569359 AACACAGTGTTTACTAAAATTGG + Intronic
1008841066 6:55904925-55904947 AGCACAGAGTTGATTGAAATGGG - Intergenic
1009607157 6:65886135-65886157 ACCACAGATATGAGAAAAAGGGG - Intergenic
1009697516 6:67126806-67126828 AAAACATAGATGAAGAAAATTGG - Intergenic
1009827646 6:68887636-68887658 AACAAAGAGTTAAGTCAAATTGG - Intronic
1010952103 6:82049081-82049103 AACAAATAGATAAGGAAAATAGG - Intergenic
1011414806 6:87107045-87107067 AAAGAAAAGATGAGTAAAATTGG - Intergenic
1011566211 6:88675354-88675376 AATACAGAGTTGAGTAGAAATGG - Intronic
1012342222 6:98141928-98141950 ATCACAGAGATTCTTAAAATTGG - Intergenic
1013636243 6:112032362-112032384 AGCACAGTGATGAGTAGCATAGG - Intergenic
1014184142 6:118416191-118416213 AACACAGGAATGAGTCAAATGGG - Intergenic
1014363551 6:120510451-120510473 AGAACAGAGCTGGGTAAAATTGG - Intergenic
1014723636 6:124949924-124949946 AACACAGAGATAAGCACATTGGG + Intergenic
1015307907 6:131730974-131730996 GACAAAGAGATGGGAAAAATAGG - Intronic
1015568105 6:134594795-134594817 AACACAAAGATGGATAAAGTAGG - Intergenic
1015903555 6:138092616-138092638 AACACAAAGATGAAAAAAATAGG - Intronic
1015941284 6:138454918-138454940 AACACAGAGATCAACAAGATAGG + Intronic
1016794088 6:148099284-148099306 AACACACAAATGATTAAAAGTGG + Intergenic
1016802790 6:148183506-148183528 CTCACAGAGAGGAGTAAAAAAGG - Intergenic
1016947063 6:149545343-149545365 AACACATAGAAAACTAAAATGGG + Intronic
1017948823 6:159118419-159118441 AGCACAGAGAGGAATAGAATTGG - Intergenic
1018543377 6:164908530-164908552 AGCACAGAGAAGAGGAAATTAGG + Intergenic
1018545377 6:164929857-164929879 ACCATAGAGATGAGGAAACTGGG - Intergenic
1020807445 7:12808229-12808251 AACACAGAGATTAGGACCATGGG - Intergenic
1021422158 7:20457802-20457824 AAGAAAAAGAAGAGTAAAATAGG + Intergenic
1022144496 7:27523644-27523666 AGCAGAGAGATCAGTAAAGTAGG - Intergenic
1022308077 7:29169114-29169136 AAAACTGAAATGAATAAAATGGG - Intronic
1023797973 7:43809619-43809641 AAAACAGAGAGGATAAAAATTGG + Intergenic
1023880317 7:44315415-44315437 AATACATAGATCAGTGAAATAGG - Intronic
1024221992 7:47296128-47296150 CACACAAAGATGAGTATAATGGG + Intronic
1024304474 7:47915807-47915829 TGCATAGAGATGAGCAAAATAGG - Intronic
1024311546 7:47974248-47974270 GACACAAAGATGATTAAGATGGG + Intronic
1025617085 7:63129744-63129766 CACACACAGAAGAATAAAATTGG - Intergenic
1026072831 7:67137815-67137837 ACCACAGAGATGAGAAAACTAGG - Intronic
1026704050 7:72674394-72674416 ACCACAGAGATGAGAAAACCAGG + Intronic
1027436920 7:78174250-78174272 AGCTCAGAGATTAGTAAAAGGGG + Intronic
1027608743 7:80332797-80332819 AACAAATAGTTGAGTTAAATAGG - Intergenic
1029019709 7:97351563-97351585 GACACACAGATGAATAAAAATGG + Intergenic
1030320269 7:108159806-108159828 AACAAATAGATTGGTAAAATAGG - Intronic
1030359883 7:108584093-108584115 GACACATAGATCAGTAATATAGG + Intergenic
1030575472 7:111280767-111280789 AACAAAGAAAGGAGTGAAATTGG + Intronic
1030989721 7:116285771-116285793 AACATATAGATGAGAAATATGGG + Intergenic
1031069586 7:117147096-117147118 AAAACAGTGTTGAGTAAAACAGG - Intronic
1032895072 7:136241098-136241120 AAGACAAAGATGAGGAAACTGGG + Intergenic
1033434372 7:141319766-141319788 ATCACAGAGTTCAGAAAAATAGG + Intronic
1033528949 7:142244225-142244247 AACAGAGAGAAGAGGGAAATGGG - Intergenic
1033858523 7:145595558-145595580 TAGACAAAAATGAGTAAAATGGG - Intergenic
1036725889 8:11220529-11220551 AACAAAGAAATAAGTAAAAAGGG + Intergenic
1036806622 8:11839021-11839043 AACAAAATGATGAGAAAAATAGG - Exonic
1036957083 8:13199724-13199746 AACATAGAGGTGAGGGAAATGGG + Intronic
1037031036 8:14106004-14106026 AAAACACAGATGAAAAAAATTGG + Intronic
1037464595 8:19148136-19148158 AACACAGAGATGAGGCTAATGGG - Intergenic
1037685490 8:21135837-21135859 AAAACAGAGAAGAATCAAATAGG - Intergenic
1038068160 8:23984673-23984695 ATCCCAGAGATGGGTAGAATGGG + Intergenic
1038558150 8:28542958-28542980 AACAAAGGGATGAGTAGGATAGG + Intronic
1038900848 8:31842008-31842030 AATTCAGAGCTGAGTAGAATGGG - Intronic
1039297963 8:36178402-36178424 ATAACAGAAATCAGTAAAATAGG - Intergenic
1041483202 8:58345662-58345684 AGAACAGAGAGGAGTGAAATGGG + Intergenic
1041847093 8:62341900-62341922 AGCACAGAGAAAAGTTAAATGGG - Intronic
1041938299 8:63358887-63358909 AACAGAGAGAACAATAAAATGGG - Intergenic
1042511896 8:69620557-69620579 AAGACAGAGATGAATTTAATTGG - Intronic
1042954879 8:74239012-74239034 AACAGGGTGATGAGTAAAATGGG + Intronic
1043266051 8:78268389-78268411 AATACAAAGATGGGTAAACTTGG - Intergenic
1043488105 8:80718897-80718919 AACACAAAGATGAGGACAACGGG - Intronic
1044100833 8:88136171-88136193 AAGAAAGAGATGACTAAAAAAGG + Intronic
1044136591 8:88593208-88593230 AATATAGAGATAAGTAAATTGGG - Intergenic
1044505960 8:93019710-93019732 GACACAGTGATGAGGAGAATAGG + Intergenic
1044965147 8:97567403-97567425 GAAACAGAGAAGAGTAAAATGGG - Intergenic
1045311162 8:101004319-101004341 AATACATAGATGAGTAAGATGGG + Intergenic
1045659054 8:104417424-104417446 AAGACAGAGATCAGCCAAATTGG - Intronic
1046067101 8:109210700-109210722 AAGACAGAGATGATTAAAGTAGG + Intergenic
1048660500 8:136595100-136595122 AAGAGATAGATGAGTAAAAAAGG + Intergenic
1048857986 8:138700156-138700178 ACCACAGAGATTAGAAAGATGGG + Intronic
1049366708 8:142241798-142241820 TACACACAGAAGAGTAAAAACGG + Intronic
1050019966 9:1272662-1272684 GACACAGAGATGAGTAAAGTGGG + Intergenic
1050202716 9:3163198-3163220 AACACACATAGGAGAAAAATTGG - Intergenic
1050366352 9:4877182-4877204 GACACAGAGATGAGAAAGAGTGG - Intronic
1051504741 9:17814550-17814572 GACACAGAGATGGGAACAATAGG + Intergenic
1051891184 9:21944689-21944711 AGTACAGAGATGAGCAAAGTTGG + Intronic
1053054701 9:34987739-34987761 GACACAGAGATGGGTAAGGTGGG - Intergenic
1053176964 9:35933225-35933247 AACACAGAGAATAGTATAATGGG + Intergenic
1053506616 9:38648898-38648920 AATACCGCGATGAGCAAAATGGG - Intergenic
1057484182 9:95469243-95469265 AAGTCAGAGCTGTGTAAAATGGG - Intronic
1057993186 9:99794610-99794632 AAAACAGAAATGACCAAAATTGG - Intergenic
1058250208 9:102684674-102684696 AACAAAAAGAAGAGAAAAATAGG - Intergenic
1058492936 9:105521689-105521711 AAAAAAGAGAAGAGGAAAATGGG + Intronic
1058716519 9:107727155-107727177 AATACAGAGATGAGAAAGAAAGG - Intergenic
1058726694 9:107811505-107811527 AACATACAAATGAATAAAATAGG - Intergenic
1058730308 9:107843634-107843656 AATACAAAGATGAATAAAATGGG + Intergenic
1059652138 9:116324858-116324880 AGCACAGAGAGCAGTGAAATTGG + Intronic
1059680059 9:116577201-116577223 AACTCAGAGGCCAGTAAAATGGG + Intronic
1060870831 9:127038908-127038930 ATGACAGAGAAGAGTAAAAGAGG + Intronic
1203517415 Un_GL000213v1:15544-15566 AATACAAGGATGAGCAAAATTGG - Intergenic
1185690127 X:2147836-2147858 AACACACAGATGAAAATAATTGG - Intergenic
1186517693 X:10178659-10178681 AAAACAGACATCAGGAAAATGGG - Intronic
1186703880 X:12121774-12121796 GACCCAGAGATGAGTAACCTTGG - Intergenic
1187019425 X:15364785-15364807 AAAACAAAGATGAGCAAAAGGGG + Intronic
1187042459 X:15611121-15611143 AAAACAGTGTTTAGTAAAATTGG - Intergenic
1187563758 X:20427794-20427816 AACAAACAGATGAGTAAAGAAGG + Intergenic
1187897081 X:23991936-23991958 AAGAAAAAGATGAGAAAAATCGG - Intronic
1188392185 X:29634376-29634398 AAAACAGAGAGGAGTCAAAGTGG + Intronic
1189726445 X:43972031-43972053 AACAGAGAGATGACTGAAATGGG - Intronic
1189758319 X:44295190-44295212 GACACAGAGAAGAGTAATAAGGG + Intronic
1190229585 X:48571871-48571893 GACACAGAGAAAAATAAAATTGG + Intergenic
1190475883 X:50827052-50827074 AACCCATAGATAAGAAAAATTGG - Intergenic
1190804355 X:53820766-53820788 AACACAATGATGAATACAATGGG + Intergenic
1191640042 X:63421668-63421690 AAAACACTGATGAATAAAATTGG - Intergenic
1191945333 X:66528012-66528034 AACACACAGAGGAGGAAAAAAGG + Intergenic
1192000707 X:67147951-67147973 AACAGAGAGAAGAATCAAATAGG - Intergenic
1192272721 X:69598184-69598206 GACACATAGATCAATAAAATGGG + Intergenic
1192662409 X:73055620-73055642 AAAAGAGAGAAGAGTCAAATAGG + Intergenic
1193400389 X:81035927-81035949 AAAAGAGAGAAGAATAAAATAGG + Intergenic
1193637561 X:83971110-83971132 AAAACAGAGAAGAATCAAATAGG + Intergenic
1194523416 X:94945870-94945892 AACAGAGAGATGAATCAAATAGG + Intergenic
1195658343 X:107354648-107354670 AATATAGAAATGAATAAAATAGG - Intergenic
1196303591 X:114073777-114073799 AACAAGGAGATGAACAAAATTGG + Intergenic
1197868698 X:131045602-131045624 GACAGAGAGATGAGAAGAATGGG - Intergenic
1197950237 X:131887275-131887297 AAAACACAGATTAGTAAAGTTGG + Intergenic
1198009367 X:132535240-132535262 AACACAGAGCTGAGTGAAAGTGG - Intergenic
1198234745 X:134726421-134726443 AATACTGAGATGAATAAAACAGG - Intronic
1198672712 X:139098692-139098714 AACACAGAGATGGGAACAATAGG + Intronic
1199380583 X:147167850-147167872 AACACACAGATGAGACAAAATGG - Intergenic
1199519424 X:148718761-148718783 GATACAGAGATGAATAAAACAGG - Intronic
1200947059 Y:8853167-8853189 AACACAGAGAAGACTTAATTAGG - Intergenic