ID: 914942491

View in Genome Browser
Species Human (GRCh38)
Location 1:152035547-152035569
Sequence TCACTTTGGAGAATTACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914942491_914942493 12 Left 914942491 1:152035547-152035569 CCAGAGGTAATTCTCCAAAGTGA 0: 1
1: 0
2: 1
3: 33
4: 231
Right 914942493 1:152035582-152035604 CAATTATCAAATTACTAAAATGG 0: 1
1: 0
2: 2
3: 38
4: 535
914942491_914942494 17 Left 914942491 1:152035547-152035569 CCAGAGGTAATTCTCCAAAGTGA 0: 1
1: 0
2: 1
3: 33
4: 231
Right 914942494 1:152035587-152035609 ATCAAATTACTAAAATGGAACGG 0: 1
1: 0
2: 1
3: 40
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914942491 Original CRISPR TCACTTTGGAGAATTACCTC TGG (reversed) Intronic
900275868 1:1827435-1827457 TCACTAAGGAAAAATACCTCAGG + Intronic
905942668 1:41876188-41876210 ACATTTTGGAGAATTATATCAGG - Intronic
906410354 1:45573881-45573903 TCAATTTGGAGGATTATCTGAGG + Intergenic
907924940 1:58946525-58946547 TCACTTAAGATAATGACCTCCGG + Intergenic
910576397 1:88769674-88769696 TCACTTTGCATAATGTCCTCTGG - Intronic
911949397 1:104153662-104153684 TCACTTTGGCGAATTGGCTGAGG - Intergenic
912191827 1:107349524-107349546 TCACTTGGGAGAAATACATAAGG - Intronic
913349648 1:117843069-117843091 TCACTGTGGTGAATGACCACAGG + Intergenic
914942491 1:152035547-152035569 TCACTTTGGAGAATTACCTCTGG - Intronic
916230189 1:162534032-162534054 TCACTTAGGAGAACGAACTCAGG + Intergenic
916401750 1:164457006-164457028 TCACTTAGCATAATGACCTCCGG - Intergenic
916428884 1:164708676-164708698 TCACTTAGGATAATGGCCTCCGG + Intronic
916864737 1:168844169-168844191 TCACTTTGCACAACTATCTCTGG - Intergenic
917202275 1:172530518-172530540 TCACATTGGAGAAGTACTACTGG - Intergenic
917448105 1:175123765-175123787 CCACTTTGAAGAATGTCCTCGGG - Intronic
917805074 1:178606043-178606065 TTTCTTTGGAGAATTTCCCCAGG - Intergenic
919470954 1:197978577-197978599 TCACTTAGGATAATGTCCTCTGG + Intergenic
919569353 1:199226885-199226907 TCAGTTTGGAGAATGGGCTCTGG - Intergenic
921584051 1:216927419-216927441 TCACTTTGCAGAGCTCCCTCAGG - Intronic
921680984 1:218030707-218030729 TCTCTTTGAACAATTACCTCAGG - Intergenic
922956558 1:229606673-229606695 TCACTTTAAAGAATTAACACTGG + Intronic
923441532 1:234025096-234025118 TCACTTAGGATAATGGCCTCCGG + Intronic
1064110064 10:12530822-12530844 TGACGTTGGAGAATTACTTGAGG + Intronic
1067169131 10:43891666-43891688 TCACTTAGGATAATAACCTCTGG - Intergenic
1067717571 10:48701205-48701227 TCACTTTGTATAATTCTCTCAGG + Intronic
1070234762 10:74611751-74611773 TCACTTTGGATAATGTCCTCTGG + Intronic
1071861718 10:89680759-89680781 TCACTTAGCAAAATTACCTCTGG - Intergenic
1073147463 10:101290224-101290246 TCACTTTGGAGTTTTTCCTGAGG - Intergenic
1073347092 10:102791678-102791700 TTAATTTGGAGCATCACCTCTGG - Intronic
1075019680 10:118942548-118942570 TCATTTTGGATTATTTCCTCAGG - Intergenic
1075027016 10:118992795-118992817 CCACTTTGGACAATGACCTGAGG + Intergenic
1075569776 10:123531550-123531572 TCGCTTAGGATAATAACCTCCGG + Intergenic
1075985607 10:126782771-126782793 TCACTGGGGAGAATTTCCTGGGG - Intergenic
1076389450 10:130087618-130087640 TCACTTGGGACCATCACCTCCGG - Intergenic
1078324279 11:10366948-10366970 TCACTTTGGAGAACTTCCAAGGG - Intronic
1078724800 11:13920418-13920440 CCACTTTGGAAACTTACTTCAGG - Intergenic
1080003779 11:27382219-27382241 TAACTTGGGGGAATTTCCTCAGG - Exonic
1081435421 11:43022432-43022454 TCTCTTTTCAGAATGACCTCAGG + Intergenic
1085032932 11:73283575-73283597 TCACTTTGGAGATTTCCTTGTGG + Intronic
1086415239 11:86582551-86582573 TCAATTTGGAGCATTTCCTAAGG + Intronic
1088423765 11:109677701-109677723 TCACTTTGCAGAGTTATCTTTGG + Intergenic
1088516842 11:110645831-110645853 TCACTTAGGATAATGGCCTCCGG - Intronic
1088769933 11:113024049-113024071 TCACTTTGGAGGGTTCCCTTGGG + Intronic
1090097673 11:123759534-123759556 AGACTTTGGTTAATTACCTCAGG - Intergenic
1090102300 11:123812098-123812120 TCACTTAGGATAATGGCCTCTGG + Intergenic
1092141396 12:6186156-6186178 TGACTTTGGGGACTTTCCTCAGG - Intergenic
1093117632 12:15231315-15231337 TCCCTTTGGAGAAGTATCTGGGG + Intronic
1093801702 12:23381622-23381644 TCACTTATGATAATTACCTCTGG - Intergenic
1094432063 12:30380336-30380358 GCACTTTGGAGAATTACTCCTGG + Intergenic
1094754173 12:33447284-33447306 TCACTTAGGATAATGGCCTCTGG - Intergenic
1098286340 12:68911214-68911236 TCTCTTTGGAGAGTGACCTCTGG + Intronic
1098843079 12:75501077-75501099 TCACTTTGGAGGGTTACTTTAGG + Exonic
1100733151 12:97496221-97496243 TCACTTTTGAGGATTAACTATGG + Intergenic
1101711638 12:107272793-107272815 GCACTTTGGAGGATGACCTCAGG + Intergenic
1102417642 12:112778462-112778484 TCACTTTGAAGAATAATGTCAGG + Intronic
1107042963 13:35968098-35968120 TCACTTAGCATAATGACCTCAGG - Intronic
1108010473 13:46002633-46002655 TCACTTAGCAGAATGTCCTCAGG - Intronic
1109316432 13:60754818-60754840 TTACTTTGCATAATTAACTCAGG - Intergenic
1109851308 13:68067998-68068020 TCATTTTGAAGAATTAACTTTGG + Intergenic
1110334984 13:74317555-74317577 TCACTTTATAGAATTACATTAGG - Intergenic
1110500169 13:76218149-76218171 TCACTTTTGAAAATGACTTCAGG + Intergenic
1110545164 13:76747809-76747831 TCACTTAGGATTATTGCCTCTGG - Intergenic
1111077816 13:83262178-83262200 TCACTTTGGAAAAATAAGTCTGG - Intergenic
1111357340 13:87125893-87125915 TCACTTAGGATAATGGCCTCTGG - Intergenic
1113436487 13:110296032-110296054 TCACTTTTGAGAACTTTCTCTGG - Intronic
1115850821 14:37588559-37588581 GCACTTTGGAGACCTGCCTCGGG - Intergenic
1116796755 14:49399502-49399524 TCACTTAGGATAATGGCCTCTGG - Intergenic
1117201208 14:53391886-53391908 TTCCTTGGGAGAAGTACCTCGGG + Intergenic
1117647664 14:57868708-57868730 GCACTTTGGTGAATCACCTGAGG - Intronic
1118479659 14:66151738-66151760 TCACTTAGGATAATGGCCTCTGG - Intergenic
1118638597 14:67771253-67771275 TTGCTTTGGATAATGACCTCTGG + Intronic
1119084143 14:71724246-71724268 TCACTTTGTAATATTCCCTCTGG - Intronic
1121415919 14:93779272-93779294 TCACTTTGGAGCAGGACTTCTGG + Exonic
1123677941 15:22730753-22730775 TCACTTTGGTGAATTTACTGTGG + Intergenic
1124004933 15:25787945-25787967 TCACCTTGGGGACTTCCCTCTGG + Intronic
1124330138 15:28805020-28805042 TCACTTTGGTGAATTTACTGTGG + Intergenic
1125205100 15:37145298-37145320 TCACTTAGGATAATGGCCTCTGG - Intergenic
1125550012 15:40538105-40538127 TCCCCTTGGAGAACTGCCTCTGG - Intronic
1130808050 15:87347830-87347852 TCACTCTTCAGAATTACCCCAGG + Intergenic
1134793738 16:17014856-17014878 TCACTTAGGATAATAGCCTCCGG + Intergenic
1135738058 16:24949258-24949280 TCACTTTGGAGAGTAACTTGGGG - Intronic
1138118299 16:54377842-54377864 TCACTATGAAGAAATACCTGAGG - Intergenic
1139333929 16:66217509-66217531 AGTCTTTGGAGAATTACCTCCGG - Intergenic
1139436552 16:66939976-66939998 CCACTTTGGTGAATTATCTGGGG + Intronic
1143895563 17:10133822-10133844 TCACTTTGCATAATGTCCTCTGG + Intronic
1146544833 17:33729068-33729090 TCACTATGAAGAAATACCTGAGG + Intronic
1146732790 17:35209778-35209800 TCGCTTAGGATAATGACCTCTGG - Intergenic
1147728709 17:42583136-42583158 CCACTTTGAAAAATTATCTCTGG - Intronic
1149381323 17:56096977-56096999 TCACTTAGGATAATGGCCTCTGG - Intergenic
1151996933 17:77615595-77615617 CCACGTTGGCCAATTACCTCTGG - Intergenic
1152615313 17:81335137-81335159 TGACTTTGTAGCATTAGCTCAGG - Intergenic
1152747209 17:82046613-82046635 TCACTTAGGAGAAAAGCCTCAGG + Intergenic
1153056110 18:948259-948281 TCACTTAGGAGAATGGCCTCCGG + Intergenic
1157419036 18:47530045-47530067 TCACTTAGGAGAATGAATTCAGG - Intergenic
1158157597 18:54443258-54443280 TTACTGTGGAGCATCACCTCAGG - Intergenic
1159377524 18:67612823-67612845 TCACTTAGGAAAATCGCCTCCGG - Intergenic
1159416593 18:68157331-68157353 AAACTTAGGAGAATTACCTCAGG - Intergenic
1159574773 18:70162224-70162246 TCACTTAGGATAATGGCCTCTGG - Intronic
1164945499 19:32289894-32289916 TCACTTAGCAGAATGTCCTCAGG + Intergenic
1165847847 19:38830221-38830243 TCAGATTGGAGAATTTCCACTGG - Intronic
925759685 2:7172362-7172384 TGTCTTTGGAGAATAACCTGTGG - Intergenic
926080931 2:9985796-9985818 TAACTTTGGAAAATGACATCAGG + Intronic
928931811 2:36632602-36632624 TCACTTGGGAGAATACCTTCGGG - Intronic
928948868 2:36796875-36796897 TCACTTTGCACAATTTCCTGAGG - Intronic
929925911 2:46208439-46208461 TCACTTAGGATAATGGCCTCTGG + Intergenic
930884801 2:56313647-56313669 TAACTTTGGGGAATTGCCTATGG + Intronic
933400615 2:81792283-81792305 TCAGTTTGGAGAATAATCTGGGG - Intergenic
935716718 2:105945745-105945767 TCACTTAGTATAATGACCTCAGG - Intergenic
937002915 2:118484573-118484595 TCTCTTTCCAGACTTACCTCTGG + Intergenic
938556458 2:132429161-132429183 TCACTTTGCAGAACTGCCTGAGG + Intronic
938816732 2:134912228-134912250 TCACTTTACATAATGACCTCTGG + Intergenic
939215213 2:139228250-139228272 TCTTTTTGCAGACTTACCTCAGG + Intergenic
939272914 2:139963161-139963183 TCATTCTGGAGAATTAGCTAAGG - Intergenic
939774535 2:146368196-146368218 TCACTTTGGATAATGGCCTCTGG + Intergenic
943155549 2:184170399-184170421 TAGCTTAGGATAATTACCTCTGG - Intergenic
944759391 2:202798053-202798075 TCACTTTGCATAATGTCCTCTGG + Intronic
947060400 2:226158009-226158031 TCACTTAGGATAATGACCTCCGG + Intergenic
948275180 2:236703004-236703026 TCACTTTGCATAATGACCTCAGG + Intergenic
1170256900 20:14354912-14354934 TCACTTAGGATAATGACCTCTGG + Intronic
1170717687 20:18846170-18846192 TCACTGTGAAGAAATACCTAAGG - Intergenic
1171138595 20:22721064-22721086 ACACTTTGGAAAATTACTTGGGG - Intergenic
1171727919 20:28642817-28642839 TCACTTTAGAGTTTTACCTAAGG + Intergenic
1173721588 20:45263076-45263098 TCACTTAGGATAATGGCCTCCGG + Intergenic
1175912082 20:62409833-62409855 ACATTTAGGAGAATTACCTCTGG + Intergenic
1178415741 21:32403679-32403701 TCACTTAGCATAATGACCTCAGG - Intergenic
1178685038 21:34703862-34703884 TTTCTTTCGAGAATTACCTTTGG + Intronic
950996675 3:17505484-17505506 TCACTGTGAAGAAATACCTGAGG - Intronic
952488601 3:33842185-33842207 TCACTTTGGTGAATTTACTGTGG + Intronic
953013225 3:39048230-39048252 TCACTTAAGATAATGACCTCCGG - Intergenic
953681032 3:45038220-45038242 ACACTTTGGAGAATTTCCCAGGG + Intergenic
955207981 3:56914708-56914730 TCACTTTGCATAATGTCCTCTGG - Intronic
955402959 3:58606562-58606584 TCCTTTTGGAGAATCACATCTGG + Intronic
956001839 3:64738087-64738109 CCACTTTTGAGAATAAGCTCTGG + Intergenic
957235288 3:77580841-77580863 TCCTTTTGGAGAAATACCTAGGG + Intronic
960345548 3:116526951-116526973 TAACTTTGGAGAGAGACCTCTGG - Intronic
960420729 3:117442183-117442205 TCTCTCTAGAGAATTAGCTCTGG + Intergenic
962034251 3:131634374-131634396 TCACTTTGAATAATTTCTTCAGG + Intronic
963761597 3:149291081-149291103 TCAATTTCCAGAATTACCTGGGG - Intergenic
966396644 3:179510681-179510703 TCACATTGGAGATTTGCCTCAGG - Intergenic
966614189 3:181896711-181896733 TCGCTTTAGAGTATTCCCTCAGG - Intergenic
967495632 3:190142172-190142194 TCACTTAGGATAATGGCCTCCGG + Intergenic
967602284 3:191404475-191404497 TTACTAGGAAGAATTACCTCAGG + Intergenic
970749720 4:19343319-19343341 TCATTTTGGACAATTATTTCAGG - Intergenic
971040818 4:22750134-22750156 TCACTTTCCAGAATTCCTTCTGG - Intergenic
971259393 4:25042666-25042688 TCTCTTTGGAAAAATACCACGGG + Intergenic
975372620 4:73606279-73606301 TCACTTAGGATAATAGCCTCCGG - Intronic
975674637 4:76813896-76813918 TCACTTTGGAGGATTATTTTAGG - Intergenic
975720297 4:77242691-77242713 TCAGTTTGGTCAATTACCCCTGG + Intronic
976845557 4:89485087-89485109 TCACTTAGGATAATGGCCTCTGG + Intergenic
977719039 4:100217294-100217316 TCACTTAAGACAATGACCTCTGG + Intergenic
979253481 4:118588940-118588962 TCACAGTGGAAAATGACCTCTGG + Intergenic
980811414 4:137886209-137886231 TCACTTTCTAGAGTTTCCTCAGG + Intergenic
981845427 4:149162565-149162587 TCACTTTGGATAATGGCCTGAGG - Intergenic
981872332 4:149501722-149501744 TAACTTTGGAGAATAAACACTGG + Intergenic
983794374 4:171842451-171842473 TCACTATGAAGAAATACCTGAGG + Intronic
984324897 4:178240047-178240069 TCACTTAGGATAATGACCTCTGG - Intergenic
984595102 4:181657849-181657871 TCACTTAGGATAATGGCCTCCGG - Intergenic
985432621 4:189896049-189896071 TCACTTTAGAGTTTTACCTAAGG - Intergenic
985436656 4:189936937-189936959 TCACTTAGGATAATGGCCTCCGG + Intergenic
985954353 5:3252145-3252167 TCGGTTTGGAGAATTACTCCTGG + Intergenic
986151261 5:5132693-5132715 TCAATTTGGAGAATTCCCCGGGG - Intergenic
986268306 5:6209699-6209721 TCACTTAGGATAATATCCTCCGG - Intergenic
987419501 5:17702165-17702187 TCACTTAGGATAATGGCCTCTGG - Intergenic
987931758 5:24409529-24409551 TGAGTTTGGAGTATAACCTCAGG - Intergenic
988894220 5:35654455-35654477 TGACTATGGAGAAAGACCTCAGG - Intronic
989406665 5:41068706-41068728 TCACTTAAGAGAATAACCTCCGG - Intronic
990921130 5:60968989-60969011 CCACTTTGCATAATGACCTCTGG + Intronic
992687870 5:79215781-79215803 GCACTTTGGAGGATCACCTGAGG + Intronic
993666418 5:90703790-90703812 TTTCTTTGCAGTATTACCTCAGG - Exonic
993979837 5:94531887-94531909 TCATTTTGTAGAATTTGCTCTGG + Intronic
994207798 5:97055410-97055432 GCACTTTGCAGGATGACCTCAGG - Intergenic
994467337 5:100154644-100154666 TCACTTAGGATAATCACCTATGG - Intergenic
994479470 5:100315526-100315548 TTGCTTGGGAGAATGACCTCTGG - Intergenic
994890145 5:105623071-105623093 GCACTCAGGAGAATTACCTGAGG - Intergenic
995304512 5:110629955-110629977 CCCCTTTGGAGAAGTAACTCAGG - Intronic
995425565 5:112018453-112018475 TTACTTTGGAGACCTGCCTCTGG - Intergenic
996770630 5:127081955-127081977 TCACTTGGGATAATGGCCTCTGG - Intergenic
997043774 5:130289249-130289271 GCACTCTGGGGAATTACCTGGGG - Intergenic
997829405 5:137136874-137136896 TCTCTTTGGAGAATTCTCTTTGG - Intronic
998245327 5:140496947-140496969 TCACTTTTCAGAGTTACCTCAGG + Exonic
999019204 5:148144438-148144460 TAACTTTAGATAATTACCACAGG - Intergenic
1000175690 5:158750462-158750484 TCATTTTGGATAATTACCTTTGG - Intronic
1002096339 5:176833418-176833440 TCACTTAGGATAATGGCCTCCGG + Intronic
1002299926 5:178252237-178252259 TCACTTAGGATAATGGCCTCTGG + Intronic
1003311883 6:4975771-4975793 TCACTTAGAATAATAACCTCCGG + Intergenic
1003488084 6:6596828-6596850 GTACTTTGGAGAATTAACTCAGG - Intronic
1005365921 6:25077034-25077056 TCACTTTAAAGAATTGCTTCAGG + Intergenic
1005430824 6:25754918-25754940 TCACTTACCAGAATTATCTCAGG - Intronic
1010130341 6:72485395-72485417 GCACGTTTGAGAATTACCTCAGG - Intergenic
1013441285 6:110172646-110172668 TCACTTAGGATAATGGCCTCTGG - Intronic
1014504749 6:122241643-122241665 TCACTTAGGATAATGGCCTCTGG - Intergenic
1014650780 6:124034397-124034419 TCACTTAGGATAATGACCTCTGG + Intronic
1015567132 6:134585272-134585294 TCATTTTGAAGTATTATCTCAGG + Intergenic
1016584844 6:145673016-145673038 TCACATTAGAGGATTTCCTCTGG - Intronic
1017897752 6:158695803-158695825 TCACTTAGCAAAATTTCCTCAGG + Intronic
1017970425 6:159307564-159307586 CCAAATTGGAGAATTTCCTCTGG + Intergenic
1018756619 6:166855057-166855079 TCACTTAGGATAATGGCCTCCGG - Intronic
1020860718 7:13489170-13489192 TCCCTGTGGAGTTTTACCTCTGG - Intergenic
1023731651 7:43197570-43197592 TCAGTTTGGAGAAATCGCTCAGG - Intronic
1024129336 7:46334648-46334670 TCACTTAGCATAATTTCCTCAGG + Intergenic
1025804505 7:64817573-64817595 TCACATTGGAGAATTGCTTCGGG - Intronic
1028928717 7:96389218-96389240 TCACTTTAGAAAAATCCCTCTGG - Intergenic
1030463286 7:109867925-109867947 TCACTTAGGATAATGGCCTCTGG - Intergenic
1030669728 7:112322910-112322932 ACACTTTGGAGAATTAGTCCAGG - Intronic
1030866134 7:114703953-114703975 TGACTTTGCATAATAACCTCTGG + Intergenic
1031171421 7:118296637-118296659 TCACTTTGGCAACTTTCCTCTGG + Intergenic
1031558759 7:123211065-123211087 TCACTTTGAAGGATAAGCTCTGG + Intergenic
1031670868 7:124543346-124543368 TCACTTAGAATAATTTCCTCAGG + Intergenic
1032506825 7:132441897-132441919 TCACTTTGGAGAAGTCCTTCAGG + Intronic
1033422148 7:141213141-141213163 TCACATTGGAGATTTGCATCTGG + Intronic
1033622682 7:143076442-143076464 TCACTGTGCAGATTCACCTCTGG - Intergenic
1034069232 7:148166693-148166715 TCACCTTGGATAATTATCACAGG + Intronic
1034369847 7:150585354-150585376 TCTCTTTGGTTAATTACCGCAGG - Intergenic
1036105360 8:5832237-5832259 TTACTTTGGAGAAATACATTTGG + Intergenic
1037040060 8:14220503-14220525 TCACTTTGTAAAAATCCCTCAGG + Intronic
1037478248 8:19278576-19278598 TCACTTTGGTAAATTTACTCTGG + Intergenic
1038100528 8:24369050-24369072 TTACTTTGTAGAACTACCACTGG - Intergenic
1039090993 8:33829455-33829477 TCACTTAGGATAATGGCCTCTGG + Intergenic
1039285434 8:36034850-36034872 TCACTTGAGAACATTACCTCTGG + Intergenic
1041652798 8:60317655-60317677 TCACTTAGGATAATGACCTCAGG - Intergenic
1042170142 8:65983401-65983423 TCACTATGAAGAAGTACCTGAGG + Intergenic
1042751729 8:72164603-72164625 TCACTTAAGATAATGACCTCTGG + Intergenic
1045445032 8:102252642-102252664 TCACTTTGTAAAATAACCTTTGG + Intergenic
1046741009 8:117829060-117829082 TCCTTTTGGAGAATTCACTCTGG - Intronic
1047016467 8:120728616-120728638 TCACTTAGGATAATGGCCTCTGG + Intronic
1047427797 8:124762412-124762434 TCACTTTTGACAAATACTTCTGG + Intergenic
1050753893 9:8976042-8976064 TCACTTTGAAATATTTCCTCAGG + Intronic
1052491195 9:29170313-29170335 TCACTTAGGATAATGGCCTCTGG - Intergenic
1054344153 9:63897719-63897741 TCACTTTAGAGTTTTACCTAAGG + Intergenic
1055349424 9:75370997-75371019 TCCTTTAGGAGAATCACCTCAGG - Intergenic
1056805874 9:89728577-89728599 TGACTTTGGTGAATTACTCCAGG + Intergenic
1058797795 9:108515541-108515563 TGTCTTTGGAGGATTGCCTCAGG + Intergenic
1060598103 9:124860179-124860201 TCACCTTGTAGAATTTCCTGAGG + Exonic
1061128879 9:128695644-128695666 GCACTTTGCAGGATGACCTCAGG + Exonic
1062712066 9:137980784-137980806 TCACTTAGGATAATGGCCTCTGG + Intronic
1203453349 Un_GL000219v1:141732-141754 TCACTTTAGAGTTTTACCTAAGG + Intergenic
1203421064 Un_KI270448v1:6527-6549 TCACTTTAGAGTTTTACCTAAGG - Intergenic
1203421634 Un_KI270521v1:6042-6064 TCACTTTAGAGTTTTACCTAAGG - Intergenic
1185469741 X:375211-375233 TCCCTTTGGAGACTTACCGGGGG - Intronic
1185634240 X:1539705-1539727 TTACTTTGGAGAATGGCCTCCGG - Intergenic
1185793579 X:2946053-2946075 TCACTATGGAGAACTTCCTCGGG - Exonic
1186502892 X:10066263-10066285 TCACTTTGGAGAGTGCCCTGAGG + Intronic
1187116507 X:16357582-16357604 TCACTTAGCATAATAACCTCCGG + Intergenic
1187252863 X:17614677-17614699 TCACGTTTGAAAATTAACTCAGG + Intronic
1188212161 X:27439819-27439841 GCACTTTGGAGATTCATCTCTGG - Intergenic
1188356412 X:29197333-29197355 TCTGTTTGGAGAATTATCTCAGG + Intronic
1188882320 X:35504292-35504314 TTACTTTGGTAAATTTCCTCAGG + Intergenic
1189992769 X:46610262-46610284 TCACTTTTGAAAATGACTTCTGG - Intronic
1190876711 X:54465304-54465326 TCAGTTTGGAGATTCTCCTCTGG + Intronic
1190879584 X:54483151-54483173 TCTCTCTGGAGAATTCCCTCAGG - Intronic
1191861912 X:65672551-65672573 TCACTTTGGAGGATTAGCTCAGG + Intronic
1192222079 X:69204094-69204116 TCACTATGGAGCAGTAGCTCTGG + Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1193352365 X:80478117-80478139 TCAATTTCCAGAATTACCTGGGG - Intergenic
1193600980 X:83508424-83508446 TCACTTTGGAGAAGTTTCTGAGG - Exonic
1193700682 X:84756972-84756994 GCACTTTGCAGGATGACCTCAGG + Intergenic
1193847503 X:86492730-86492752 TCACTTAGGACAATGGCCTCCGG + Intronic
1195114378 X:101682379-101682401 TAACTTTGGAGAATAACAACAGG - Intergenic
1195138021 X:101931012-101931034 TCACTTTGGAGAGTTTTCTTTGG - Intronic
1196034203 X:111125432-111125454 TCACTTATGATAATAACCTCTGG - Intronic
1196652719 X:118185032-118185054 TCACTTAGGAGAATGGCCTCTGG - Intergenic
1197355911 X:125437344-125437366 TCAATTTGCAGAATCACCTAGGG + Intergenic
1198527619 X:137518061-137518083 TCACTTTAGTCACTTACCTCTGG + Intergenic
1201412065 Y:13709371-13709393 GAACTTTAGAGAATTACCTTAGG - Intergenic
1202049360 Y:20764584-20764606 TCACTTTGGAGAATGACCAGGGG + Intronic