ID: 914947377

View in Genome Browser
Species Human (GRCh38)
Location 1:152079265-152079287
Sequence CTCACTGCCCAGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914947365_914947377 18 Left 914947365 1:152079224-152079246 CCTAACTTCCCAGACAGGGTGGC No data
Right 914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG No data
914947369_914947377 9 Left 914947369 1:152079233-152079255 CCAGACAGGGTGGCGGCCTGGCA No data
Right 914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG No data
914947368_914947377 10 Left 914947368 1:152079232-152079254 CCCAGACAGGGTGGCGGCCTGGC No data
Right 914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG No data
914947371_914947377 -7 Left 914947371 1:152079249-152079271 CCTGGCAGAGGCACTCCTCACTG No data
Right 914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914947377 Original CRISPR CTCACTGCCCAGATGGGGCA GGG Intergenic
No off target data available for this crispr