ID: 914947568

View in Genome Browser
Species Human (GRCh38)
Location 1:152080253-152080275
Sequence GGCTGCTTCCCCATTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914947560_914947568 25 Left 914947560 1:152080205-152080227 CCAGGAGGAAGTGAGGTTTCCCT No data
Right 914947568 1:152080253-152080275 GGCTGCTTCCCCATTGCTACAGG No data
914947562_914947568 6 Left 914947562 1:152080224-152080246 CCCTGAGTCTCCAGGAGACTAGA No data
Right 914947568 1:152080253-152080275 GGCTGCTTCCCCATTGCTACAGG No data
914947567_914947568 -4 Left 914947567 1:152080234-152080256 CCAGGAGACTAGAGGTGGAGGCT No data
Right 914947568 1:152080253-152080275 GGCTGCTTCCCCATTGCTACAGG No data
914947563_914947568 5 Left 914947563 1:152080225-152080247 CCTGAGTCTCCAGGAGACTAGAG No data
Right 914947568 1:152080253-152080275 GGCTGCTTCCCCATTGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914947568 Original CRISPR GGCTGCTTCCCCATTGCTAC AGG Intergenic
No off target data available for this crispr