ID: 914948236

View in Genome Browser
Species Human (GRCh38)
Location 1:152085925-152085947
Sequence CAACATGGAGAGTCTGTGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914948236_914948239 -7 Left 914948236 1:152085925-152085947 CCTTGCACAGACTCTCCATGTTG 0: 1
1: 0
2: 2
3: 18
4: 185
Right 914948239 1:152085941-152085963 CATGTTGGTCCCCTTGACTCTGG 0: 1
1: 0
2: 2
3: 9
4: 103
914948236_914948240 -6 Left 914948236 1:152085925-152085947 CCTTGCACAGACTCTCCATGTTG 0: 1
1: 0
2: 2
3: 18
4: 185
Right 914948240 1:152085942-152085964 ATGTTGGTCCCCTTGACTCTGGG 0: 1
1: 0
2: 2
3: 9
4: 115
914948236_914948244 10 Left 914948236 1:152085925-152085947 CCTTGCACAGACTCTCCATGTTG 0: 1
1: 0
2: 2
3: 18
4: 185
Right 914948244 1:152085958-152085980 CTCTGGGAGTCCCCTTGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914948236 Original CRISPR CAACATGGAGAGTCTGTGCA AGG (reversed) Exonic
900402682 1:2479044-2479066 CGAGATGGAGGCTCTGTGCAGGG + Intronic
900715967 1:4144089-4144111 CAACACGGAGAAGGTGTGCAGGG + Intergenic
900825105 1:4920110-4920132 CAGCAAAGAGAGTTTGTGCAGGG + Intergenic
901419841 1:9143458-9143480 CCACAGGAAGAGGCTGTGCAGGG - Intergenic
901825948 1:11861227-11861249 CAAAATGGACAGTCCTTGCAAGG + Intergenic
903739058 1:25547740-25547762 CAACATGGAAATGGTGTGCAGGG + Intronic
906146441 1:43563513-43563535 CAACATGGAGAGTCGGTTCCTGG - Intronic
906770068 1:48475732-48475754 CCTCATGGAGAACCTGTGCAAGG + Intergenic
907332780 1:53682133-53682155 CAACAGGAAGCATCTGTGCAGGG - Intronic
908699177 1:66880056-66880078 CAAAATAGAGAGCTTGTGCAGGG - Intronic
911419156 1:97617547-97617569 CAACATTGAGAGTAAGTTCAGGG + Intronic
912606953 1:111001206-111001228 CAAAATAGAGAGCTTGTGCAGGG - Intergenic
914948236 1:152085925-152085947 CAACATGGAGAGTCTGTGCAAGG - Exonic
915942253 1:160125782-160125804 CAAACTGGGTAGTCTGTGCATGG - Intronic
916100973 1:161392936-161392958 CAACAGGGAGAGTTAGGGCAGGG - Intergenic
919419858 1:197356100-197356122 TAACATGGCTAGACTGTGCAAGG + Intronic
922182256 1:223244485-223244507 GAAGAAGGAGAGTCTGTGGATGG + Intronic
923325498 1:232876725-232876747 CAACTTGTTGAGTCTGTGTATGG + Intergenic
923682446 1:236129056-236129078 CAATTTGGAGAGTCAGTGGATGG - Intergenic
924483572 1:244458931-244458953 CCACACAGAGTGTCTGTGCAAGG + Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1066043808 10:31579263-31579285 CATCATGGTGATTCTGGGCAGGG - Intergenic
1067799712 10:49350645-49350667 AAAGATGGAGTGTCTGTGCTTGG + Intergenic
1069799257 10:71072098-71072120 CAACACTGAGAGGCTGGGCAGGG + Intergenic
1071409574 10:85375699-85375721 CAACATTGAGAGTTTGGCCAAGG + Intergenic
1072948641 10:99833539-99833561 AAAGATGGAGACTCTGTGCCAGG + Intronic
1074340904 10:112629048-112629070 CAACATGGAGAGGGTCTGCTAGG - Intronic
1074574096 10:114652148-114652170 TAACATTGAGAGTCTGTGTCAGG - Intronic
1076377890 10:130003613-130003635 CCATTTGGGGAGTCTGTGCAGGG - Intergenic
1077444440 11:2583771-2583793 CAGCCTGGAGTGGCTGTGCATGG + Intronic
1079813167 11:25021778-25021800 GAATATAGAGAGTCTGTGAAGGG + Intronic
1084774656 11:71367547-71367569 CAACAGGAAGACTCTGAGCAGGG + Intergenic
1085376605 11:76068206-76068228 CAAGATGGAGGCTATGTGCAGGG + Intronic
1088927140 11:114313963-114313985 CAACAGGGAGATTCTGGGTAGGG - Intergenic
1089362554 11:117900756-117900778 CAAGCTGGAGAGGCTGGGCAGGG - Intronic
1089669151 11:120040414-120040436 CCCAATGGAGAGTGTGTGCAGGG - Intergenic
1090060293 11:123458796-123458818 CAACATGTAGAGTGTGTATACGG + Intergenic
1092326247 12:7534487-7534509 CAGCATGGAGACCCTGTGCCTGG - Intergenic
1093297041 12:17404000-17404022 CAAGAGGGAGAACCTGTGCAGGG - Intergenic
1098290786 12:68955480-68955502 CAACATGGTGAGTGTGTGTGGGG + Intronic
1099905121 12:88762000-88762022 CCTCATGGAGAGTCTCTGCTAGG - Intergenic
1100657829 12:96666555-96666577 CAAGCTGGAGAGCATGTGCAGGG + Intronic
1101431872 12:104633705-104633727 CAAGAGGGAGAGGCTGGGCACGG - Intronic
1101880754 12:108623965-108623987 CAACATGGGGAACCTGTCCACGG - Exonic
1103204425 12:119117357-119117379 CAACATGGAGAGATGGGGCAGGG - Intronic
1103796459 12:123506410-123506432 CAACATGTAGGGGCTGTGCAAGG + Intronic
1104861668 12:131927476-131927498 CCACATGGCCAGTGTGTGCAGGG - Intergenic
1106178359 13:27350353-27350375 CCACAAAGAGAGTCTATGCAGGG - Intergenic
1108120264 13:47178192-47178214 CAACAATGAGTGTCTGTTCAAGG - Intergenic
1111868956 13:93806226-93806248 CAATTTGGAGAGTATGTTCATGG + Intronic
1113364760 13:109665737-109665759 CAATATGGAGAAACTCTGCAAGG + Intergenic
1114335369 14:21683917-21683939 CATAATGAAGAGTGTGTGCAGGG - Intergenic
1116125454 14:40778524-40778546 AAAGATGGAGAGACTTTGCAAGG - Intergenic
1122405425 14:101498021-101498043 CAAGATGTACAGTGTGTGCAAGG - Intergenic
1123166622 14:106331207-106331229 CACCATGCAGACTCTGTGAAGGG - Intergenic
1123169308 14:106356246-106356268 CACCATGCAGACTCTGTGAAGGG - Intergenic
1202851811 14_GL000225v1_random:25308-25330 CAACATGGATGATCAGTGCAGGG - Intergenic
1123898460 15:24851571-24851593 GACCATGGAGAGGCTGTGAAGGG + Intronic
1124840372 15:33235800-33235822 CACCTTGGAGAGTCTGAGGAAGG - Intergenic
1125503742 15:40254839-40254861 CCACATGGATAGACTGTGCTAGG - Intronic
1127336758 15:57994095-57994117 CAGCGTTGAGAGTCTGGGCAAGG + Intronic
1128542258 15:68544292-68544314 AAACATGCAGTGTGTGTGCATGG + Intergenic
1128620633 15:69146523-69146545 CAACATGGAGCAGCTGTGCCTGG - Intergenic
1128658056 15:69477034-69477056 GAACGTGCAGAGTCTGTGCAGGG - Intergenic
1129043808 15:72714852-72714874 CAACATGGAGATTCTGGCAAAGG - Intronic
1129759781 15:78122739-78122761 CACCTTAGAGAGTCTGAGCAAGG - Intronic
1129996529 15:80011232-80011254 CCACATTGAGAGGCTGGGCACGG + Intergenic
1131574602 15:93574140-93574162 CAAGTTGGGGAGTCTTTGCATGG - Intergenic
1132011696 15:98282028-98282050 CAACAGAGAGAGCTTGTGCAGGG - Intergenic
1133323461 16:4929234-4929256 AAAAATGGAGAGTCTCTGCAAGG - Intronic
1134557536 16:15178603-15178625 GAACACTGGGAGTCTGTGCATGG - Intergenic
1134918104 16:18090286-18090308 GAACACTGGGAGTCTGTGCATGG - Intergenic
1141171738 16:81696014-81696036 CAAGAGGGAGAGTCAGTGCTGGG + Intronic
1142140983 16:88472788-88472810 CATCAGGGAGAGCCTGTGCCGGG - Intronic
1142436037 16:90058084-90058106 AAATATGGAGAGTGTGGGCAAGG - Exonic
1143115022 17:4577235-4577257 CCACAGGGAGAGTGCGTGCAGGG + Intergenic
1147312985 17:39606017-39606039 CTACGTGCAGACTCTGTGCAAGG - Exonic
1147595855 17:41716664-41716686 GAACATGGCGTGTCTGTGTAAGG - Intergenic
1148772630 17:50076076-50076098 CAACCTGGAGACCCTGTGGATGG + Intronic
1155510676 18:26573307-26573329 CAAGATGGAAATTCTGTGGATGG + Intronic
1165122947 19:33574075-33574097 GAACATGGAGTGTGTTTGCATGG - Intergenic
1165139041 19:33688243-33688265 CAACAGGGCCAGGCTGTGCATGG - Intronic
1168565688 19:57420425-57420447 CAACAAGGTGAGCCTGTGTAAGG - Exonic
1168677017 19:58285982-58286004 CAACATGGTGAAGCTCTGCATGG - Exonic
925218353 2:2116786-2116808 CCACGTGGAGAGGCTGTGCAGGG + Intronic
925458426 2:4039484-4039506 CAACTTGAAGATTCTGTGAATGG + Intergenic
930721213 2:54640017-54640039 CAGCATGTATAGTCTCTGCATGG + Intronic
931576612 2:63723502-63723524 CAACATGGAGATTCTGTTCTGGG - Intronic
934165163 2:89287806-89287828 GAAAATGGAGGGTCTGTGCGTGG - Intergenic
934202110 2:89894656-89894678 GAAAATGGAGGGTCTGTGCGTGG + Intergenic
935224189 2:101038808-101038830 CCACAAGGGGAGGCTGTGCAAGG + Intronic
936344786 2:111667168-111667190 ACAAATGGAGAGACTGTGCAGGG + Intergenic
936706653 2:115083203-115083225 CAACAGGGAGAGTTTGTGGATGG - Intronic
936969606 2:118164600-118164622 CAGCATGGAGATTCTGGGCCCGG - Intergenic
937321311 2:120962405-120962427 CATCATGGGGACTCTGGGCAGGG - Intronic
938399376 2:130976115-130976137 ACACATGGAGAGGTTGTGCAAGG + Intronic
939221002 2:139301498-139301520 GAACATGGAGAGTATGTGTGGGG - Intergenic
940381468 2:153019209-153019231 CAAGAGGGAGAGCTTGTGCAGGG + Intergenic
944322298 2:198361345-198361367 CAAAATGGTGTGTATGTGCATGG - Intronic
946440786 2:219693426-219693448 CAAGAGAGAGAGTCTGTGCAGGG + Intergenic
947060279 2:226156810-226156832 CAACAGGGACAGTCTGTGAGGGG + Intergenic
948227676 2:236324366-236324388 CAACTTGGAAAGACTGTGGAGGG + Exonic
948433329 2:237934599-237934621 CAACATCCAGCGTCTGTACAAGG - Intergenic
1168827943 20:826513-826535 CAAAAAAGAGAGCCTGTGCAGGG - Intergenic
1169792774 20:9429009-9429031 CTACATGGAGAGTCTTTACTAGG + Intronic
1170560604 20:17554987-17555009 CTTCATGTAGAGTCTATGCATGG - Intronic
1170981060 20:21213299-21213321 CGACAGGGAGAGTCAGAGCATGG - Intronic
1175141954 20:56867313-56867335 CACCATGGTGAGTGTGTGCAGGG - Intergenic
1175493652 20:59396521-59396543 CACCATGCCGGGTCTGTGCAAGG + Intergenic
1176123506 20:63464810-63464832 CACCTGGGAGAGTCTGTGCGCGG - Intronic
1177268109 21:18810120-18810142 CAACATGAAGAGTATGTGGGAGG + Intergenic
1178002807 21:28182570-28182592 CCTCATGGAGAGTCTCTGCTAGG + Intergenic
1178099570 21:29253114-29253136 CCACATGGAGAATCTCTGCCAGG - Intronic
1179408042 21:41141346-41141368 CCACAGGCAGAGGCTGTGCAAGG + Intergenic
1181151299 22:20885351-20885373 GCACATGGAGTGTCTGTGCACGG + Intronic
1181597913 22:23929209-23929231 CAACATGGACACTGTGTGCACGG + Intergenic
1183666803 22:39250770-39250792 CTACATGGAGAGGCTATGCAGGG + Intergenic
1183709107 22:39491964-39491986 CAACAGGGAGAGTCTGGGTGGGG + Exonic
1184730801 22:46369959-46369981 CTACACGGAGAGACTGTGCTTGG - Intronic
949621443 3:5817043-5817065 CAACAGGCAGAGTCTGTGCATGG + Intergenic
950101885 3:10362278-10362300 CAGCATGGACTGGCTGTGCAGGG + Intronic
950535886 3:13577883-13577905 CAACCTGGAGATACTCTGCATGG + Intronic
951912756 3:27768620-27768642 CCACATGGCGTGTCTGTGCCTGG + Intergenic
953137139 3:40190746-40190768 CAAATTGGAGATTCTGGGCATGG + Intronic
954980277 3:54739482-54739504 TAACATGGAGAGTGCCTGCAAGG + Intronic
956379049 3:68646775-68646797 CAACTTGGAGAGAGTGTGGAGGG - Intergenic
963586068 3:147190525-147190547 CAACATGAACAGTCAGTGTAAGG - Intergenic
966720920 3:183062028-183062050 CAAGCAGGAGAGCCTGTGCAGGG - Intronic
967117143 3:186352286-186352308 CAGCATTGAGAGTCTGGGCTTGG - Intronic
968523186 4:1043708-1043730 CAACACTGAGAGTCTGTGTTTGG + Intergenic
969847648 4:9931872-9931894 CCACATGGAGAGTGACTGCAGGG + Intronic
972385310 4:38560124-38560146 GTACATGGGGAGTATGTGCAGGG + Intergenic
972761953 4:42115143-42115165 CAACATTCAGAATCTGTGGATGG + Exonic
973072841 4:45886364-45886386 CAAGAGAGAGAGCCTGTGCAGGG - Intergenic
973571404 4:52243311-52243333 CAACATGGTGCTTCTGTGGAGGG + Intergenic
974786996 4:66631344-66631366 CAACATTCATAGTCTGTGCAGGG - Intergenic
976225033 4:82789140-82789162 TAGCAAGGAGACTCTGTGCATGG - Intronic
978368959 4:108011409-108011431 CAAGAGGGAGAGCATGTGCAGGG + Intronic
978668705 4:111219435-111219457 GATCATGAAGAGTTTGTGCAGGG - Intergenic
979295512 4:119028501-119028523 CAACATGTAAAGTATGTGAATGG - Intronic
985599774 5:821212-821234 CATCATGGAGAGTGTGGGCAGGG - Intronic
988857608 5:35244592-35244614 CAACAAGAAGAGCCAGTGCAAGG - Intergenic
990013343 5:51026983-51027005 CAATATGGAGAGTCTGTTCAAGG - Intergenic
991680352 5:69133777-69133799 GAACTTGGAAAGTCTGTGGATGG + Intergenic
995020660 5:107363787-107363809 CAACATTGAGAATATGTGTATGG + Intergenic
995589138 5:113680378-113680400 AATGATGGAGAGGCTGTGCAGGG + Intergenic
995898593 5:117043682-117043704 CAACATGTAAATGCTGTGCATGG + Intergenic
997088313 5:130826924-130826946 CCACATGGAGAGCCTCTGCTAGG - Intergenic
998227432 5:140337760-140337782 ATACATGGAGAGGCTGGGCAAGG - Intronic
999646324 5:153720492-153720514 AAACATGGAGACTCTGGGCGTGG - Intronic
1001148603 5:169206357-169206379 GAACATGGAGAATCTGTGGTGGG - Intronic
1002191111 5:177478124-177478146 CCACCTGGAGAGTCTGAGGATGG + Intergenic
1004422211 6:15480817-15480839 CAAAATCAAGAGTCTGTGCATGG + Intronic
1005061423 6:21780228-21780250 CCAGATGGAGACTTTGTGCAGGG + Intergenic
1006340896 6:33446474-33446496 CAACATGCAGTGGCTGTGCTTGG + Intronic
1007265342 6:40591422-40591444 CAAAAGGGTGAGTCTGTGAAGGG - Intergenic
1009050582 6:58271028-58271050 CCAGATGGAGATTGTGTGCATGG + Intergenic
1009239837 6:61171356-61171378 CCAGATGGAGATTGTGTGCATGG - Intergenic
1009649276 6:66452258-66452280 CAACATGGAGAGCATATGAAAGG - Intergenic
1010762133 6:79735460-79735482 CAACAGGTAGAGTGTGTGGAAGG - Intergenic
1016024317 6:139270485-139270507 CAAATTGGAGAGTCTGTGCCGGG - Exonic
1017209751 6:151842007-151842029 GAACATGTAGAGACTGAGCATGG - Intronic
1020575327 7:9918983-9919005 TAAAATGGAGAGGCTGGGCATGG - Intergenic
1020976549 7:15013718-15013740 CAACATGGTGAGGCAGGGCAAGG - Intergenic
1022926130 7:35057770-35057792 CAACATGGAGTTGCTGTGCCAGG - Intergenic
1023038067 7:36150228-36150250 CAAAATTTAGTGTCTGTGCATGG + Intergenic
1028156610 7:87436839-87436861 CAACATAGAGTGGCGGTGCAGGG - Intronic
1028724082 7:94067630-94067652 CAAAATGTAGAGATTGTGCAAGG - Intergenic
1028887402 7:95949177-95949199 CAAAAAGGAGAGTGTGGGCAAGG + Intronic
1029824140 7:103172457-103172479 CAACATGGAGTTGCTGTGCCAGG - Intergenic
1030646356 7:112065886-112065908 CAAAATGGAGCTTCTGTCCAAGG + Intronic
1033455090 7:141495968-141495990 AAACATGAAGAGGCTGTGAATGG - Intergenic
1034718348 7:153264341-153264363 CCACATGGAGAATCTCTGCTAGG - Intergenic
1034995948 7:155577441-155577463 CAGCATGACGAGGCTGTGCAGGG + Intergenic
1038181704 8:25235094-25235116 CAAAAAGGAGAATTTGTGCAGGG - Intronic
1038715746 8:29989323-29989345 GAACTTGGAATGTCTGTGCAGGG - Intergenic
1039835219 8:41250485-41250507 CAAAAAAGAGAGTGTGTGCAGGG + Intergenic
1040705826 8:50125902-50125924 CTATGTGTAGAGTCTGTGCAAGG + Intronic
1045036226 8:98178473-98178495 CAAAGTGTAGACTCTGTGCAGGG + Intergenic
1045346316 8:101297023-101297045 CAACATGGAGAGGCTCTCCTGGG - Intergenic
1045965946 8:108024727-108024749 CAACAAGGATAGGCTGGGCATGG + Intronic
1046492088 8:114966754-114966776 CAAAAGAGAGAGTGTGTGCAGGG - Intergenic
1052311574 9:27074531-27074553 CAACATGGAGGGTTTGTACAGGG + Intergenic
1052320865 9:27165844-27165866 CCACCAGGGGAGTCTGTGCAAGG + Intronic
1054777729 9:69138167-69138189 CAGCATGGAGGGTCTGGGTATGG - Intronic
1056801463 9:89694998-89695020 CAAACTGGGGAGCCTGTGCAAGG - Intergenic
1057041268 9:91849267-91849289 CAACATGGAGAATCAATCCAGGG + Intronic
1061690420 9:132323490-132323512 GAACAGGAAGAGTGTGTGCAAGG + Intronic
1062022044 9:134324438-134324460 TAATATGGAGAGTCTGCGCTCGG - Intronic
1062068575 9:134542202-134542224 CAAGAGAGAGAGCCTGTGCAGGG + Intergenic
1062308509 9:135922846-135922868 CAAAAAAGAAAGTCTGTGCAGGG - Intergenic
1062451576 9:136617896-136617918 CCACATGAAGAGGCTGGGCAGGG + Intergenic
1062457056 9:136644837-136644859 CCACAGGAAGAGTCTGAGCAGGG - Intergenic
1186082542 X:5948978-5949000 CCCCATGGAGAGGCTATGCATGG - Intronic
1186824524 X:13326070-13326092 CATCATAGTGAGTCTGTGAAAGG + Intergenic
1186864447 X:13705730-13705752 CAACATGGAAATTGTGTGAAAGG + Intronic
1188772623 X:34172624-34172646 CAACATGGATAATCTGGACAAGG + Intergenic
1188886547 X:35558078-35558100 GAGAATGGAGAATCTGTGCAAGG - Intergenic
1193246529 X:79236840-79236862 CAAAGTGGAGAGTCTGTGTGGGG + Intergenic
1193386883 X:80883266-80883288 ACACATGGAGAGTCTGAGCAGGG + Intergenic
1193485209 X:82078729-82078751 CCTCATGGAGAATCTCTGCAAGG - Intergenic
1194501628 X:94689370-94689392 AAAAAGGGAGAGTTTGTGCAGGG - Intergenic
1199177415 X:144806986-144807008 CAGGATAGAGAGTGTGTGCAGGG + Intergenic
1199191509 X:144977229-144977251 CAAAATGAAGAGACTGAGCAAGG + Intergenic
1200065024 X:153500113-153500135 GAACATGGAGGGTCCGTGCCAGG - Intronic
1201389339 Y:13480254-13480276 GAAAATGGAGTGTCTGTGCTGGG + Exonic