ID: 914950254

View in Genome Browser
Species Human (GRCh38)
Location 1:152107804-152107826
Sequence GGCGTAGCTGTTCCTCCTCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 2, 2: 2, 3: 7, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914950249_914950254 20 Left 914950249 1:152107761-152107783 CCGTCACGCTGTTGGGGGCGCAG 0: 1
1: 0
2: 0
3: 1
4: 78
Right 914950254 1:152107804-152107826 GGCGTAGCTGTTCCTCCTCGCGG 0: 1
1: 2
2: 2
3: 7
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914950254 Original CRISPR GGCGTAGCTGTTCCTCCTCG CGG Exonic
902377050 1:16034850-16034872 GGCCTGGCTGTTGCTCCTCTGGG + Intergenic
902382224 1:16058109-16058131 GGCCTGGCTGTTGCTCCTCTGGG + Exonic
914950254 1:152107804-152107826 GGCGTAGCTGTTCCTCCTCGCGG + Exonic
914950264 1:152107876-152107898 GGCGGAGCTGTTCCTCCTCGCGG + Exonic
914950281 1:152108020-152108042 GGCGCAGCTGTTCCTCCTCACGG + Exonic
914950295 1:152108116-152108138 GGAGCTGCTGTTCCTCTTCGCGG + Exonic
914950305 1:152108188-152108210 GGAGCAGCTGTTCCTCTTCACGG + Exonic
914950321 1:152108332-152108354 GGAGCAGCTGTTCGTCTTCGCGG + Exonic
914950344 1:152108524-152108546 GGCGCAGCTGTTCCTCCTCGCGG + Exonic
914950362 1:152108644-152108666 GCAGCTGCTGTTCCTCCTCGAGG + Exonic
914950381 1:152108806-152108828 GGAGCAGCTGTTCCTCTTCGCGG + Exonic
914950412 1:152109067-152109089 GCAGCCGCTGTTCCTCCTCGAGG + Exonic
914950430 1:152109181-152109203 GGAGCAGCTGTTCCTCCTCGCGG + Exonic
914964890 1:152247152-152247174 GGCATAGATGGTCCTCCTCTTGG + Intergenic
919742681 1:200990305-200990327 GGAGGAGCTGTTCCTCCTGCAGG - Exonic
1075025453 10:118980295-118980317 GGCCCACCTGTTCCTCCTGGTGG - Intergenic
1082260267 11:50072665-50072687 GGCCCAGCTCTTCCTCCTGGTGG - Intergenic
1082815084 11:57502465-57502487 GGGGTAGCTGACCCTCCTGGTGG + Intronic
1087297034 11:96389738-96389760 GGGGAAGCCGTGCCTCCTCGCGG - Intronic
1090931321 11:131300392-131300414 GGCATCGTTGTTCCTCGTCGGGG - Intergenic
1107133402 13:36919924-36919946 GGCGAAGTTGTTCGTCCTCGGGG - Intronic
1122626359 14:103087303-103087325 TGCGTGGCTGTCCTTCCTCGAGG + Intergenic
1127964788 15:63915528-63915550 GGCTTAGCTCTTCCTCCCCTGGG - Intronic
1131583769 15:93671835-93671857 GGTGCAGCTGTTCCTCTTAGGGG + Intergenic
1134614756 16:15642782-15642804 GGCGCCGCTGTTCCCCTTCGAGG - Intronic
1142355765 16:89601058-89601080 GGCGGAGGAGCTCCTCCTCGGGG + Intergenic
1145305105 17:21669775-21669797 GGCCTCGCTGCTCCTCCTCTGGG + Intergenic
1148200317 17:45746047-45746069 AGCTTAGGTGTTCCTCCTCTGGG - Intergenic
1149994599 17:61400044-61400066 GGCGCAGCAGCTGCTCCTCGGGG - Exonic
1151214518 17:72568552-72568574 TGCGTGGCTCTTCCTCCTCAGGG - Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1161042304 19:2116649-2116671 GACGCCGCTGCTCCTCCTCGTGG + Exonic
1161593536 19:5139856-5139878 GGCGTAGCGGGGCCTCATCGTGG + Intronic
1164143886 19:22498394-22498416 GGAGTTGTTGTTCCTCCTGGTGG + Intronic
928445462 2:31329943-31329965 GGCATAGCTGTTTCTCCAGGAGG - Intergenic
931229477 2:60362184-60362206 TGCGTAGCTGTTCCTCTTTGAGG - Intergenic
1171522617 20:25787246-25787268 GGCCTCGCTGCTCCTCCTCTGGG + Intronic
1171554210 20:26068637-26068659 GGCCTCGCTGCTCCTCCTCTGGG - Intergenic
1174299230 20:49569431-49569453 GGAGAAGCTGTTGCTCCTCCTGG + Intergenic
1176719191 21:10379495-10379517 GACTAGGCTGTTCCTCCTCGGGG - Intergenic
1179562466 21:42224305-42224327 GGCGTAGCAGCTCCTCCAAGAGG + Intronic
1180135426 21:45859232-45859254 GGCTCAGCTGTTCCTGGTCGGGG - Intronic
1180300418 22:11032424-11032446 GACTAGGCTGTTCCTCCTCGGGG - Intergenic
1185026765 22:48418621-48418643 GGATCAGCAGTTCCTCCTCGGGG + Intergenic
959452748 3:106523417-106523439 GACTTAGCTTTTCCTCCTGGTGG + Intergenic
963266708 3:143246934-143246956 GGCCTAACTGTTCCTCCTCTGGG - Intergenic
967919417 3:194603337-194603359 GATGTAGCTGGTGCTCCTCGGGG + Intronic
984886366 4:184453532-184453554 GGAGGAGCTGTGCCTTCTCGAGG - Intronic
994022042 5:95038470-95038492 GGTGTAGATGCTCCTCCTCAAGG + Intronic
1017758023 6:157546117-157546139 AGCTTAGCTGTACCTCCTCCAGG + Intronic
1018310068 6:162499328-162499350 AGAGCAGCTGTTCCTCCTCTAGG + Intronic
1020402224 7:7792256-7792278 GGCTTAGCTGTTCCTGTTCTTGG + Intronic
1025977282 7:66378985-66379007 GGCCCAGCTCTTCCTCCTGGCGG - Intronic
1026845014 7:73693856-73693878 GGCGTGTCAGTTCCTTCTCGTGG + Intronic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1034427827 7:151023901-151023923 GGGGTTGCTGCTCCTCCCCGTGG + Exonic
1035817970 8:2561720-2561742 GGCTCAGCAGTTTCTCCTCGGGG - Intergenic
1040915712 8:52565106-52565128 GCCGTTGCTTTTCCTCCCCGCGG - Exonic
1041416874 8:57620297-57620319 GGCCTCGCTGTTCATCCTCTTGG - Intergenic
1047552705 8:125893909-125893931 GAAGTAGCTGTTCATCCTTGGGG + Intergenic
1050212361 9:3275232-3275254 GGCGTAGCAATTCCACCTCTAGG - Intronic
1053239654 9:36486375-36486397 GGGATAGCTGTTCTTTCTCGGGG + Intronic
1057058669 9:91983680-91983702 GGCTGAGCTGTTCCTCATCGTGG - Intergenic
1057606124 9:96498964-96498986 GGCATGTCTGTTCCTCCTGGGGG - Intronic
1057724735 9:97560347-97560369 GGAGTAACTCTTCCTCCTCCAGG - Intronic
1061822742 9:133237604-133237626 GACGAAGCTGTTATTCCTCGGGG + Intergenic
1062518985 9:136949881-136949903 GGCGCGGCTGCTCCTCCCCGTGG + Intronic
1062573435 9:137195785-137195807 GCTGTAGCTTTTCCTCTTCGTGG - Intronic
1062659235 9:137619480-137619502 GGCGAGGCTGTCCCTCCTCTCGG + Intronic
1199161961 X:144623559-144623581 GTCGTAGCTGTTCCTCATCTTGG - Intergenic