ID: 914950349

View in Genome Browser
Species Human (GRCh38)
Location 1:152108569-152108591
Sequence GCCGCTGTTGCCCGCGCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914950342_914950349 30 Left 914950342 1:152108516-152108538 CCTCTCCTGGCGCAGCTGTTCCT 0: 1
1: 3
2: 9
3: 127
4: 447
Right 914950349 1:152108569-152108591 GCCGCTGTTGCCCGCGCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 121
914950345_914950349 10 Left 914950345 1:152108536-152108558 CCTCCTCGCGGAATTTTCTGTCA 0: 2
1: 6
2: 5
3: 6
4: 51
Right 914950349 1:152108569-152108591 GCCGCTGTTGCCCGCGCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 121
914950346_914950349 7 Left 914950346 1:152108539-152108561 CCTCGCGGAATTTTCTGTCACGG 0: 1
1: 1
2: 2
3: 2
4: 15
Right 914950349 1:152108569-152108591 GCCGCTGTTGCCCGCGCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 121
914950343_914950349 25 Left 914950343 1:152108521-152108543 CCTGGCGCAGCTGTTCCTCCTCG 0: 1
1: 5
2: 5
3: 28
4: 316
Right 914950349 1:152108569-152108591 GCCGCTGTTGCCCGCGCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914950349 Original CRISPR GCCGCTGTTGCCCGCGCTCC TGG Exonic
900113798 1:1020265-1020287 GCCGCTCCAGCGCGCGCTCCGGG - Exonic
900159132 1:1215276-1215298 GCAGCTGTTTCCTGTGCTCCTGG - Intergenic
900264921 1:1752626-1752648 GCAGCTGGAGGCCGCGCTCCAGG + Exonic
902918899 1:19655152-19655174 GCCGCTGTGGCCCACGATCTGGG - Exonic
903230418 1:21918977-21918999 GCTGCTGCTGCCCGCCCTACAGG + Intronic
903324770 1:22563565-22563587 GCCGCTGCGGCCCGCGCGTCGGG - Exonic
905902223 1:41589188-41589210 GCCTCTGTTGGCCCAGCTCCTGG - Intronic
909800113 1:79796594-79796616 GCCCCTGTGGCCCAGGCTCCAGG - Intergenic
910221440 1:84893043-84893065 GCCGCAGGGGCCCCCGCTCCCGG - Intronic
912345875 1:108963129-108963151 GCCGCGGTTGCGCGCGTTCCGGG - Intronic
914950308 1:152108233-152108255 GCAGCTGTTGTTCGCGCTCCTGG + Exonic
914950349 1:152108569-152108591 GCCGCTGTTGCCCGCGCTCCTGG + Exonic
914950402 1:152108992-152109014 GCAGCTGTTGCTCGCGCTCCTGG + Exonic
915440454 1:155942399-155942421 GCCGCCGTTGCCGCCGCTGCAGG - Exonic
921328025 1:214006966-214006988 GCTGCTGTTTCCCACCCTCCAGG - Intronic
921556139 1:216601073-216601095 GCTGCTGCCGCCCGCGCTGCCGG - Intronic
923463891 1:234231498-234231520 GCCGCTGCTGGACGTGCTCCCGG + Exonic
1064408965 10:15088826-15088848 GCTGCCATTGGCCGCGCTCCCGG + Intergenic
1065188799 10:23192734-23192756 GCTGCTGCAGCCCGCGCCCCCGG + Exonic
1068714732 10:60175741-60175763 GCCTCTGAGGCCCGGGCTCCTGG - Intronic
1072578396 10:96720345-96720367 GCCGCGGGTCCCCGGGCTCCCGG - Intronic
1073061725 10:100737418-100737440 GCCGCTGTGCCACGCGCGCCGGG - Intronic
1074503584 10:114046227-114046249 CCCGCTGTCCCCCGCGCGCCTGG + Exonic
1076771544 10:132668779-132668801 GCCCCTGTTGACCGTGCTCTGGG + Intronic
1077103301 11:831579-831601 GCAGCTGCTGCCCGCCCGCCTGG - Exonic
1077242325 11:1517203-1517225 GCCTCTGTGGCCCCCGTTCCAGG + Intergenic
1078594475 11:12674645-12674667 TGGGCTGCTGCCCGCGCTCCGGG - Exonic
1081863510 11:46347470-46347492 GCCGCTGCCGCCGCCGCTCCAGG - Intronic
1083815613 11:65130808-65130830 CCCGCAGCTGCCTGCGCTCCTGG - Exonic
1084176298 11:67424099-67424121 TCCGCTGTTGCCTGGGCTGCGGG + Exonic
1084564377 11:69920909-69920931 GCCGCGGTGGGCCCCGCTCCTGG - Intergenic
1089702678 11:120254919-120254941 GCAGCTGTTTCCCATGCTCCTGG - Intronic
1094203662 12:27817931-27817953 GCTGCTGTTGCCCTGTCTCCCGG - Intergenic
1095361223 12:41342313-41342335 GCTTTTGTTGCCCGCGCTTCTGG - Intronic
1096222812 12:49842693-49842715 GCCGCTGCTGCCTGCCCGCCAGG - Intronic
1097186039 12:57196983-57197005 GCCGCTGTCGCCCTGGCTTCCGG + Exonic
1099440026 12:82687535-82687557 GCCGCTGCTGCCCTCGCGCTGGG + Exonic
1101970455 12:109309139-109309161 GCCGCCGCTGCCGGCGCTCCGGG + Exonic
1104665275 12:130643249-130643271 GCTGCTGTGGCCCGTGCACCCGG - Intronic
1104917673 12:132274282-132274304 GGCTCTGTGGCCTGCGCTCCAGG + Intronic
1104998324 12:132673054-132673076 GCCTCTGGTGCCAGCACTCCTGG + Intronic
1105480740 13:20773454-20773476 GCCGCGGGTGCCCGCCCTCCAGG + Intronic
1106187803 13:27424555-27424577 GCCGCTGCTGCGCATGCTCCGGG - Exonic
1113721176 13:112558261-112558283 GCCACTGCTGCCCACGCTGCCGG + Exonic
1113895100 13:113759275-113759297 GCCGCCGGTGCCCGGGCCCCTGG + Exonic
1114237624 14:20836221-20836243 GCTGCTGTGGCCTGCTCTCCGGG + Intergenic
1117690235 14:58298758-58298780 GCTGCTGCTGCCCGAGGTCCCGG + Intronic
1118849468 14:69573056-69573078 GCTGCTGCTGCCCGCGCTCGGGG + Exonic
1119325979 14:73759763-73759785 CCAGCTCTTGCCCGGGCTCCGGG + Exonic
1121321013 14:92991637-92991659 ACCTCTGTTGCCCGCTCGCCTGG - Intronic
1122079157 14:99254741-99254763 CCAGCTGCTGCCCACGCTCCTGG - Intronic
1128089905 15:64912173-64912195 GCCGCTGCTCCCCGCTCACCTGG - Intronic
1129919805 15:79310884-79310906 CCCGCTGTTCTGCGCGCTCCCGG - Intergenic
1131466049 15:92655602-92655624 GCTGCTGCTGCTCGCGCTCCTGG - Exonic
1132055770 15:98649350-98649372 GCCGCTGCTGCCGGCGCTGAGGG + Exonic
1132580921 16:684286-684308 GTCGCGGTTGCTCGCGCTCTGGG - Exonic
1139493503 16:67299980-67300002 GCCCCTGTTGCTGGCTCTCCTGG + Intronic
1146274675 17:31509319-31509341 GTCCCGGTTGCCCCCGCTCCTGG + Intronic
1147150235 17:38510094-38510116 GGCGCTGTGGCCCCCGCCCCAGG - Exonic
1147767873 17:42849147-42849169 GGCGCTGTAGCCAGTGCTCCGGG - Exonic
1148325795 17:46782826-46782848 GCCACTGTTCCTCGCCCTCCTGG + Intronic
1152645603 17:81467237-81467259 GCGGCTGTTGCCCCGGTTCCTGG + Intergenic
1154940719 18:21111087-21111109 GTCGCTGTTGCCCCCGGCCCGGG - Exonic
1156008448 18:32470494-32470516 GCCGCCGCTGCTCGCGCTCGCGG + Intergenic
1160682796 19:419529-419551 CCCGCTGGTGGCCGGGCTCCCGG - Intronic
1160894829 19:1397475-1397497 GACGCAGGTGCCCGCGCTGCTGG - Intronic
1161761373 19:6175330-6175352 GCTGCTGTTTCCCCTGCTCCTGG - Intronic
1162420975 19:10565909-10565931 GCTGCAGTTCCTCGCGCTCCCGG + Exonic
1162921480 19:13905902-13905924 GGCGCTGTAGACCCCGCTCCCGG + Intronic
1163615214 19:18323059-18323081 GCCGCCGCTGCACACGCTCCCGG + Exonic
1163939678 19:20480233-20480255 GCTGCTGTGGCCTGCTCTCCAGG + Intergenic
925174601 2:1773355-1773377 GCAGGTGTTGCCTGCCCTCCTGG - Intergenic
926412694 2:12620904-12620926 GCCGCAGTTTCCTGTGCTCCTGG - Intergenic
928964878 2:36966499-36966521 GCCGCTGTTGCCTCCGCTGCTGG - Intergenic
937328160 2:121004631-121004653 GCCACTGTTGCCAACCCTCCTGG - Intergenic
938092254 2:128441445-128441467 GCCTCTGTTCCCAGCTCTCCAGG - Intergenic
942044682 2:172093262-172093284 GCCGCCGTGGCTCCCGCTCCGGG - Intergenic
1169065849 20:2693699-2693721 GCCGCTGCTGCCCGCCGGCCTGG + Exonic
1170889981 20:20368469-20368491 GCCGCGCTTGCCTGCGCGCCTGG + Exonic
1173221789 20:41137577-41137599 GCCGCCGTTGCGCTTGCTCCCGG + Exonic
1175264630 20:57695249-57695271 GCCGCTGTTGCCAGCCCCGCTGG - Intronic
1176124496 20:63469457-63469479 GCCCCTGCTGCCCCCGCTCTGGG - Intronic
1176574484 21:8435821-8435843 GCCGCGGTCGGCCGCGCTCGAGG + Intergenic
1178487258 21:33026933-33026955 GCCGCTGCTGCCCTTACTCCGGG - Exonic
1180702591 22:17789731-17789753 GCCGCTGTGGCTCCCGCACCCGG + Exonic
1182771862 22:32801978-32802000 GCCGCTGCTGCCGCCGCTGCCGG - Exonic
1185313757 22:50170290-50170312 GCAGCCGCCGCCCGCGCTCCGGG + Intergenic
953705275 3:45226000-45226022 GCCCCTGCTCGCCGCGCTCCTGG - Exonic
962818134 3:139020671-139020693 GGCGCTGTGGACGGCGCTCCTGG + Exonic
965871888 3:173274843-173274865 GCCGCTGTGGCCTGCTCTCCAGG - Intergenic
968445235 4:649129-649151 GTCGCTGTTGGCCGTGCTCGGGG - Intronic
968879568 4:3292324-3292346 CTCGCTGCTGCCCGCGCTCCGGG + Intergenic
973051756 4:45607390-45607412 GCTGCTGTGGCCTGCTCTCCAGG - Intergenic
973774167 4:54230265-54230287 GCCGCTGTCGCCCCCGCGCTAGG - Intronic
980920744 4:139083690-139083712 GCCGCTGCTGCCCGCGTTCGGGG - Intronic
983620614 4:169757661-169757683 GCCGCTGTTTCGCGCTCTGCAGG - Intronic
985478277 5:91966-91988 GCCACTGCCGCCCGCGCTCGGGG + Intergenic
987081195 5:14427154-14427176 GCCCCTGTTGTCCTCCCTCCAGG + Intronic
990607332 5:57423708-57423730 CCAGCTGTTGGCCGAGCTCCAGG + Intergenic
993502075 5:88675874-88675896 GCCGCCGCCGCCCGCGCTCTCGG + Intergenic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
1002661198 5:180792143-180792165 GCTGCTGTTGGCCGAGCTCTGGG - Exonic
1002762278 6:211206-211228 GACGCAGTAGCCCGCGCTCCTGG - Intergenic
1005687820 6:28272135-28272157 GCCACTGTTGACAGAGCTCCCGG - Exonic
1006470205 6:34224336-34224358 GCGGCCGCTGCCCGCACTCCCGG + Intergenic
1008601015 6:53094771-53094793 GCTGCTGCTGCCCAGGCTCCAGG - Intronic
1011894795 6:92212137-92212159 GCTGATGTTGCCCCTGCTCCAGG + Intergenic
1015402052 6:132798372-132798394 GCCGCTGGTCTCCGGGCTCCCGG + Intronic
1020462937 7:8443937-8443959 GCCGCTGTTGCACACTCCCCTGG + Intronic
1021827986 7:24573546-24573568 GCCGCCGCTGCCGCCGCTCCCGG - Exonic
1029055122 7:97733111-97733133 CCCGCTGCTGCCCGCGACCCAGG - Intronic
1031899170 7:127391853-127391875 GCCGCAGCCGCCCGCGCTGCCGG - Intronic
1032525584 7:132576738-132576760 GCCGCCGCTGCTCGGGCTCCGGG - Exonic
1035451384 7:158979332-158979354 GCCGCTGGTGGCAGCGCTCTGGG - Intergenic
1037891643 8:22626898-22626920 TCCGCTGTAGTCAGCGCTCCTGG - Intronic
1038133438 8:24759301-24759323 GCCACTGTTGCTCGGGCTGCAGG - Intergenic
1039936518 8:42051432-42051454 GCCGCTTCTCCCCGCGCTCGCGG - Intronic
1040032934 8:42842806-42842828 GCAGCCGTTTCTCGCGCTCCTGG - Intronic
1042759076 8:72251603-72251625 GCCCCAGGTGCCCGCGCTCGTGG - Intergenic
1049572817 8:143377648-143377670 CCCGCTGGTGCCTGCGCCCCAGG + Intronic
1049614348 8:143569578-143569600 CACGCTGCTGCCGGCGCTCCTGG - Exonic
1050230054 9:3514492-3514514 CCCTCTGTTGCCCAGGCTCCGGG + Intronic
1052888880 9:33677162-33677184 GCCGCTTCTCCCCCCGCTCCAGG + Intergenic
1056126314 9:83538711-83538733 GCCGCTGTCGCTCGGGCTCCCGG + Intergenic
1059246527 9:112854361-112854383 GCTGCTGTTGTCCGCCTTCCTGG + Intronic
1061442607 9:130616527-130616549 GCCGCTGTGCTCCGTGCTCCGGG - Intronic
1203468935 Un_GL000220v1:108023-108045 GCCGCGGTCGGCCGCGCTCGAGG + Intergenic
1203476756 Un_GL000220v1:151995-152017 GCCGCGGTCGGCCGCGCTCGAGG + Intergenic
1186788631 X:12975647-12975669 GCCGGTCTTGCCTGCTCTCCCGG - Exonic
1192282919 X:69703361-69703383 GCTGCTGTGGCCTGCTCTCCAGG + Intronic
1196442259 X:115728088-115728110 GCCGCTGCTGGCCGCGCGCCGGG - Intergenic
1196857696 X:119999581-119999603 GCTGCTGCTGCCAGGGCTCCTGG + Intergenic
1196859591 X:120014929-120014951 GCTGCTGCTGCCAGGGCTCCTGG + Intergenic
1200003533 X:153073680-153073702 GCAGCTCGTGCACGCGCTCCTGG + Exonic
1200004190 X:153076329-153076351 GCAGCTCGTGCACGCGCTCCTGG - Intergenic
1200121638 X:153793987-153794009 GCCGCCGTGGCCCACTCTCCCGG + Exonic