ID: 914956767

View in Genome Browser
Species Human (GRCh38)
Location 1:152169648-152169670
Sequence CTGTCCCAGGAGAAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914956762_914956767 10 Left 914956762 1:152169615-152169637 CCTTTGTGAAGCATCAGAATCAG No data
Right 914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914956767 Original CRISPR CTGTCCCAGGAGAAGAGGGA AGG Intergenic
No off target data available for this crispr