ID: 914958839

View in Genome Browser
Species Human (GRCh38)
Location 1:152188765-152188787
Sequence CCTGCAAGTGCGCCCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914958839_914958844 7 Left 914958839 1:152188765-152188787 CCAGCAGGGGGCGCACTTGCAGG No data
Right 914958844 1:152188795-152188817 AAGTCCTTATTTACGGGATAAGG No data
914958839_914958842 1 Left 914958839 1:152188765-152188787 CCAGCAGGGGGCGCACTTGCAGG No data
Right 914958842 1:152188789-152188811 CACCTGAAGTCCTTATTTACGGG No data
914958839_914958848 19 Left 914958839 1:152188765-152188787 CCAGCAGGGGGCGCACTTGCAGG No data
Right 914958848 1:152188807-152188829 ACGGGATAAGGTGGAGGCTGAGG No data
914958839_914958847 13 Left 914958839 1:152188765-152188787 CCAGCAGGGGGCGCACTTGCAGG No data
Right 914958847 1:152188801-152188823 TTATTTACGGGATAAGGTGGAGG No data
914958839_914958841 0 Left 914958839 1:152188765-152188787 CCAGCAGGGGGCGCACTTGCAGG No data
Right 914958841 1:152188788-152188810 TCACCTGAAGTCCTTATTTACGG No data
914958839_914958845 10 Left 914958839 1:152188765-152188787 CCAGCAGGGGGCGCACTTGCAGG No data
Right 914958845 1:152188798-152188820 TCCTTATTTACGGGATAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914958839 Original CRISPR CCTGCAAGTGCGCCCCCTGC TGG (reversed) Intergenic
No off target data available for this crispr