ID: 914964702

View in Genome Browser
Species Human (GRCh38)
Location 1:152244966-152244988
Sequence TTGTATATCAAAAAGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914964700_914964702 -10 Left 914964700 1:152244953-152244975 CCTGTCTAAATTATTGTATATCA No data
Right 914964702 1:152244966-152244988 TTGTATATCAAAAAGGATGCAGG No data
914964699_914964702 23 Left 914964699 1:152244920-152244942 CCTACTGATATTGATCTAACTGA No data
Right 914964702 1:152244966-152244988 TTGTATATCAAAAAGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914964702 Original CRISPR TTGTATATCAAAAAGGATGC AGG Intergenic
No off target data available for this crispr