ID: 914965795

View in Genome Browser
Species Human (GRCh38)
Location 1:152256312-152256334
Sequence GCCACCCCATCTGGGAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965795_914965812 30 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC No data
Right 914965812 1:152256365-152256387 ATGGGGCAGCTGCCGGGCGGAGG No data
914965795_914965811 27 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC No data
Right 914965811 1:152256362-152256384 CAGATGGGGCAGCTGCCGGGCGG No data
914965795_914965806 12 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC No data
Right 914965806 1:152256347-152256369 GGGCTCCTCACTTCTCAGATGGG No data
914965795_914965807 13 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC No data
Right 914965807 1:152256348-152256370 GGCTCCTCACTTCTCAGATGGGG No data
914965795_914965805 11 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC No data
Right 914965805 1:152256346-152256368 GGGGCTCCTCACTTCTCAGATGG No data
914965795_914965801 -10 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC No data
Right 914965801 1:152256325-152256347 ATGGGGTGGCTGCCGGGTGGAGG No data
914965795_914965810 24 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC No data
Right 914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG No data
914965795_914965802 -9 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC No data
Right 914965802 1:152256326-152256348 TGGGGTGGCTGCCGGGTGGAGGG No data
914965795_914965803 -8 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC No data
Right 914965803 1:152256327-152256349 GGGGTGGCTGCCGGGTGGAGGGG No data
914965795_914965809 23 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC No data
Right 914965809 1:152256358-152256380 TTCTCAGATGGGGCAGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965795 Original CRISPR GCCACCCCATCTGGGAAGTG AGG (reversed) Intergenic