ID: 914965795

View in Genome Browser
Species Human (GRCh38)
Location 1:152256312-152256334
Sequence GCCACCCCATCTGGGAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25524
Summary {0: 532, 1: 2666, 2: 5168, 3: 10303, 4: 6855}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965795_914965803 -8 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965803 1:152256327-152256349 GGGGTGGCTGCCGGGTGGAGGGG 0: 46
1: 612
2: 1060
3: 1128
4: 2176
914965795_914965801 -10 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965801 1:152256325-152256347 ATGGGGTGGCTGCCGGGTGGAGG No data
914965795_914965805 11 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965805 1:152256346-152256368 GGGGCTCCTCACTTCTCAGATGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145
914965795_914965806 12 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965806 1:152256347-152256369 GGGCTCCTCACTTCTCAGATGGG 0: 258
1: 1867
2: 2264
3: 6789
4: 6457
914965795_914965812 30 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965812 1:152256365-152256387 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675
914965795_914965810 24 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
914965795_914965807 13 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965807 1:152256348-152256370 GGCTCCTCACTTCTCAGATGGGG 0: 274
1: 1958
2: 2549
3: 7169
4: 5245
914965795_914965809 23 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965809 1:152256358-152256380 TTCTCAGATGGGGCAGCTGCCGG 0: 23
1: 321
2: 621
3: 872
4: 1449
914965795_914965811 27 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965811 1:152256362-152256384 CAGATGGGGCAGCTGCCGGGCGG 0: 21
1: 350
2: 942
3: 1240
4: 1782
914965795_914965802 -9 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965802 1:152256326-152256348 TGGGGTGGCTGCCGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965795 Original CRISPR GCCACCCCATCTGGGAAGTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr