ID: 914965798

View in Genome Browser
Species Human (GRCh38)
Location 1:152256320-152256342
Sequence ACCCGGCAGCCACCCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10671
Summary {0: 20, 1: 280, 2: 1022, 3: 4485, 4: 4864}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965798_914965811 19 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965811 1:152256362-152256384 CAGATGGGGCAGCTGCCGGGCGG 0: 21
1: 350
2: 942
3: 1240
4: 1782
914965798_914965813 23 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965813 1:152256366-152256388 TGGGGCAGCTGCCGGGCGGAGGG 0: 18
1: 327
2: 706
3: 933
4: 1140
914965798_914965806 4 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965806 1:152256347-152256369 GGGCTCCTCACTTCTCAGATGGG 0: 258
1: 1867
2: 2264
3: 6789
4: 6457
914965798_914965809 15 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965809 1:152256358-152256380 TTCTCAGATGGGGCAGCTGCCGG 0: 23
1: 321
2: 621
3: 872
4: 1449
914965798_914965810 16 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
914965798_914965812 22 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965812 1:152256365-152256387 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675
914965798_914965805 3 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965805 1:152256346-152256368 GGGGCTCCTCACTTCTCAGATGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145
914965798_914965814 24 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151
914965798_914965807 5 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965807 1:152256348-152256370 GGCTCCTCACTTCTCAGATGGGG 0: 274
1: 1958
2: 2549
3: 7169
4: 5245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965798 Original CRISPR ACCCGGCAGCCACCCCATCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr