ID: 914965799

View in Genome Browser
Species Human (GRCh38)
Location 1:152256321-152256343
Sequence CACCCGGCAGCCACCCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965799_914965810 15 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG No data
Right 914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG No data
914965799_914965811 18 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG No data
Right 914965811 1:152256362-152256384 CAGATGGGGCAGCTGCCGGGCGG No data
914965799_914965813 22 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG No data
Right 914965813 1:152256366-152256388 TGGGGCAGCTGCCGGGCGGAGGG No data
914965799_914965812 21 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG No data
Right 914965812 1:152256365-152256387 ATGGGGCAGCTGCCGGGCGGAGG No data
914965799_914965809 14 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG No data
Right 914965809 1:152256358-152256380 TTCTCAGATGGGGCAGCTGCCGG No data
914965799_914965814 23 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG No data
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG No data
914965799_914965807 4 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG No data
Right 914965807 1:152256348-152256370 GGCTCCTCACTTCTCAGATGGGG No data
914965799_914965806 3 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG No data
Right 914965806 1:152256347-152256369 GGGCTCCTCACTTCTCAGATGGG No data
914965799_914965805 2 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG No data
Right 914965805 1:152256346-152256368 GGGGCTCCTCACTTCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965799 Original CRISPR CACCCGGCAGCCACCCCATC TGG (reversed) Intergenic