ID: 914965804

View in Genome Browser
Species Human (GRCh38)
Location 1:152256337-152256359
Sequence AAGTGAGGAGCCCCTCCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965804_914965817 27 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT No data
Right 914965817 1:152256387-152256409 GGGCTCCTCACTTCTCAGACGGG No data
914965804_914965812 5 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT No data
Right 914965812 1:152256365-152256387 ATGGGGCAGCTGCCGGGCGGAGG No data
914965804_914965809 -2 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT No data
Right 914965809 1:152256358-152256380 TTCTCAGATGGGGCAGCTGCCGG No data
914965804_914965810 -1 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT No data
Right 914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG No data
914965804_914965816 26 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT No data
Right 914965816 1:152256386-152256408 GGGGCTCCTCACTTCTCAGACGG No data
914965804_914965814 7 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT No data
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG No data
914965804_914965813 6 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT No data
Right 914965813 1:152256366-152256388 TGGGGCAGCTGCCGGGCGGAGGG No data
914965804_914965811 2 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT No data
Right 914965811 1:152256362-152256384 CAGATGGGGCAGCTGCCGGGCGG No data
914965804_914965818 28 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT No data
Right 914965818 1:152256388-152256410 GGCTCCTCACTTCTCAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965804 Original CRISPR AAGTGAGGAGCCCCTCCACC CGG (reversed) Intergenic