ID: 914965804

View in Genome Browser
Species Human (GRCh38)
Location 1:152256337-152256359
Sequence AAGTGAGGAGCCCCTCCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19317
Summary {0: 116, 1: 1406, 2: 4833, 3: 6054, 4: 6908}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965804_914965810 -1 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
914965804_914965811 2 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965811 1:152256362-152256384 CAGATGGGGCAGCTGCCGGGCGG 0: 21
1: 350
2: 942
3: 1240
4: 1782
914965804_914965814 7 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151
914965804_914965809 -2 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965809 1:152256358-152256380 TTCTCAGATGGGGCAGCTGCCGG 0: 23
1: 321
2: 621
3: 872
4: 1449
914965804_914965816 26 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965816 1:152256386-152256408 GGGGCTCCTCACTTCTCAGACGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145
914965804_914965818 28 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965818 1:152256388-152256410 GGCTCCTCACTTCTCAGACGGGG 0: 1649
1: 1802
2: 3083
3: 7973
4: 5376
914965804_914965812 5 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965812 1:152256365-152256387 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675
914965804_914965817 27 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965817 1:152256387-152256409 GGGCTCCTCACTTCTCAGACGGG 0: 1555
1: 1910
2: 1784
3: 7700
4: 7503
914965804_914965813 6 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965813 1:152256366-152256388 TGGGGCAGCTGCCGGGCGGAGGG 0: 18
1: 327
2: 706
3: 933
4: 1140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965804 Original CRISPR AAGTGAGGAGCCCCTCCACC CGG (reversed) Intergenic
Too many off-targets to display for this crispr