ID: 914965805

View in Genome Browser
Species Human (GRCh38)
Location 1:152256346-152256368
Sequence GGGGCTCCTCACTTCTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19549
Summary {0: 1678, 1: 2039, 2: 4785, 3: 5902, 4: 5145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965799_914965805 2 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG 0: 23
1: 342
2: 1114
3: 1451
4: 2868
Right 914965805 1:152256346-152256368 GGGGCTCCTCACTTCTCAGATGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145
914965798_914965805 3 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965805 1:152256346-152256368 GGGGCTCCTCACTTCTCAGATGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145
914965795_914965805 11 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965805 1:152256346-152256368 GGGGCTCCTCACTTCTCAGATGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145
914965790_914965805 26 Left 914965790 1:152256297-152256319 CCGGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 914965805 1:152256346-152256368 GGGGCTCCTCACTTCTCAGATGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965805 Original CRISPR GGGGCTCCTCACTTCTCAGA TGG Intergenic
Too many off-targets to display for this crispr