ID: 914965807

View in Genome Browser
Species Human (GRCh38)
Location 1:152256348-152256370
Sequence GGCTCCTCACTTCTCAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17195
Summary {0: 274, 1: 1958, 2: 2549, 3: 7169, 4: 5245}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965798_914965807 5 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965807 1:152256348-152256370 GGCTCCTCACTTCTCAGATGGGG 0: 274
1: 1958
2: 2549
3: 7169
4: 5245
914965790_914965807 28 Left 914965790 1:152256297-152256319 CCGGGCAGAGACGCTCCTCACTT 0: 3009
1: 4104
2: 7826
3: 9138
4: 3047
Right 914965807 1:152256348-152256370 GGCTCCTCACTTCTCAGATGGGG 0: 274
1: 1958
2: 2549
3: 7169
4: 5245
914965795_914965807 13 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965807 1:152256348-152256370 GGCTCCTCACTTCTCAGATGGGG 0: 274
1: 1958
2: 2549
3: 7169
4: 5245
914965799_914965807 4 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG 0: 23
1: 342
2: 1114
3: 1451
4: 2868
Right 914965807 1:152256348-152256370 GGCTCCTCACTTCTCAGATGGGG 0: 274
1: 1958
2: 2549
3: 7169
4: 5245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965807 Original CRISPR GGCTCCTCACTTCTCAGATG GGG Intergenic
Too many off-targets to display for this crispr