ID: 914965808

View in Genome Browser
Species Human (GRCh38)
Location 1:152256352-152256374
Sequence GCTGCCCCATCTGAGAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17486
Summary {0: 40, 1: 635, 2: 2227, 3: 3801, 4: 10783}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965808_914965822 30 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965822 1:152256405-152256427 ACGGGGCGGTTGCCAGGCAGAGG 0: 282
1: 453
2: 421
3: 2114
4: 3702
914965808_914965817 12 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965817 1:152256387-152256409 GGGCTCCTCACTTCTCAGACGGG 0: 1555
1: 1910
2: 1784
3: 7700
4: 7503
914965808_914965814 -8 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151
914965808_914965812 -10 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965812 1:152256365-152256387 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675
914965808_914965816 11 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965816 1:152256386-152256408 GGGGCTCCTCACTTCTCAGACGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145
914965808_914965813 -9 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965813 1:152256366-152256388 TGGGGCAGCTGCCGGGCGGAGGG 0: 18
1: 327
2: 706
3: 933
4: 1140
914965808_914965818 13 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965818 1:152256388-152256410 GGCTCCTCACTTCTCAGACGGGG 0: 1649
1: 1802
2: 3083
3: 7973
4: 5376
914965808_914965821 24 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965821 1:152256399-152256421 TCTCAGACGGGGCGGTTGCCAGG 0: 395
1: 833
2: 887
3: 3057
4: 9197
914965808_914965819 16 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965819 1:152256391-152256413 TCCTCACTTCTCAGACGGGGCGG 0: 2126
1: 3475
2: 3747
3: 6550
4: 5316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965808 Original CRISPR GCTGCCCCATCTGAGAAGTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr