ID: 914965808

View in Genome Browser
Species Human (GRCh38)
Location 1:152256352-152256374
Sequence GCTGCCCCATCTGAGAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965808_914965821 24 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC No data
Right 914965821 1:152256399-152256421 TCTCAGACGGGGCGGTTGCCAGG No data
914965808_914965819 16 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC No data
Right 914965819 1:152256391-152256413 TCCTCACTTCTCAGACGGGGCGG No data
914965808_914965813 -9 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC No data
Right 914965813 1:152256366-152256388 TGGGGCAGCTGCCGGGCGGAGGG No data
914965808_914965812 -10 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC No data
Right 914965812 1:152256365-152256387 ATGGGGCAGCTGCCGGGCGGAGG No data
914965808_914965814 -8 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC No data
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG No data
914965808_914965816 11 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC No data
Right 914965816 1:152256386-152256408 GGGGCTCCTCACTTCTCAGACGG No data
914965808_914965818 13 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC No data
Right 914965818 1:152256388-152256410 GGCTCCTCACTTCTCAGACGGGG No data
914965808_914965822 30 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC No data
Right 914965822 1:152256405-152256427 ACGGGGCGGTTGCCAGGCAGAGG No data
914965808_914965817 12 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC No data
Right 914965817 1:152256387-152256409 GGGCTCCTCACTTCTCAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965808 Original CRISPR GCTGCCCCATCTGAGAAGTG AGG (reversed) Intergenic