ID: 914965809

View in Genome Browser
Species Human (GRCh38)
Location 1:152256358-152256380
Sequence TTCTCAGATGGGGCAGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3286
Summary {0: 23, 1: 321, 2: 621, 3: 872, 4: 1449}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965798_914965809 15 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965809 1:152256358-152256380 TTCTCAGATGGGGCAGCTGCCGG 0: 23
1: 321
2: 621
3: 872
4: 1449
914965804_914965809 -2 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965809 1:152256358-152256380 TTCTCAGATGGGGCAGCTGCCGG 0: 23
1: 321
2: 621
3: 872
4: 1449
914965799_914965809 14 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG 0: 23
1: 342
2: 1114
3: 1451
4: 2868
Right 914965809 1:152256358-152256380 TTCTCAGATGGGGCAGCTGCCGG 0: 23
1: 321
2: 621
3: 872
4: 1449
914965795_914965809 23 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 914965809 1:152256358-152256380 TTCTCAGATGGGGCAGCTGCCGG 0: 23
1: 321
2: 621
3: 872
4: 1449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965809 Original CRISPR TTCTCAGATGGGGCAGCTGC CGG Intergenic
Too many off-targets to display for this crispr