ID: 914965811

View in Genome Browser
Species Human (GRCh38)
Location 1:152256362-152256384
Sequence CAGATGGGGCAGCTGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965795_914965811 27 Left 914965795 1:152256312-152256334 CCTCACTTCCCAGATGGGGTGGC No data
Right 914965811 1:152256362-152256384 CAGATGGGGCAGCTGCCGGGCGG No data
914965798_914965811 19 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT No data
Right 914965811 1:152256362-152256384 CAGATGGGGCAGCTGCCGGGCGG No data
914965799_914965811 18 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG No data
Right 914965811 1:152256362-152256384 CAGATGGGGCAGCTGCCGGGCGG No data
914965804_914965811 2 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT No data
Right 914965811 1:152256362-152256384 CAGATGGGGCAGCTGCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965811 Original CRISPR CAGATGGGGCAGCTGCCGGG CGG Intergenic