ID: 914965813

View in Genome Browser
Species Human (GRCh38)
Location 1:152256366-152256388
Sequence TGGGGCAGCTGCCGGGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3124
Summary {0: 18, 1: 327, 2: 706, 3: 933, 4: 1140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965798_914965813 23 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965813 1:152256366-152256388 TGGGGCAGCTGCCGGGCGGAGGG 0: 18
1: 327
2: 706
3: 933
4: 1140
914965799_914965813 22 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG 0: 23
1: 342
2: 1114
3: 1451
4: 2868
Right 914965813 1:152256366-152256388 TGGGGCAGCTGCCGGGCGGAGGG 0: 18
1: 327
2: 706
3: 933
4: 1140
914965808_914965813 -9 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965813 1:152256366-152256388 TGGGGCAGCTGCCGGGCGGAGGG 0: 18
1: 327
2: 706
3: 933
4: 1140
914965804_914965813 6 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965813 1:152256366-152256388 TGGGGCAGCTGCCGGGCGGAGGG 0: 18
1: 327
2: 706
3: 933
4: 1140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965813 Original CRISPR TGGGGCAGCTGCCGGGCGGA GGG Intergenic
Too many off-targets to display for this crispr