ID: 914965814

View in Genome Browser
Species Human (GRCh38)
Location 1:152256367-152256389
Sequence GGGGCAGCTGCCGGGCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3729
Summary {0: 207, 1: 595, 2: 988, 3: 788, 4: 1151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965804_914965814 7 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151
914965799_914965814 23 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG 0: 23
1: 342
2: 1114
3: 1451
4: 2868
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151
914965808_914965814 -8 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151
914965798_914965814 24 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT 0: 20
1: 280
2: 1022
3: 4485
4: 4864
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965814 Original CRISPR GGGGCAGCTGCCGGGCGGAG GGG Intergenic
Too many off-targets to display for this crispr