ID: 914965814

View in Genome Browser
Species Human (GRCh38)
Location 1:152256367-152256389
Sequence GGGGCAGCTGCCGGGCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965799_914965814 23 Left 914965799 1:152256321-152256343 CCAGATGGGGTGGCTGCCGGGTG No data
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG No data
914965808_914965814 -8 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC No data
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG No data
914965804_914965814 7 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT No data
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG No data
914965798_914965814 24 Left 914965798 1:152256320-152256342 CCCAGATGGGGTGGCTGCCGGGT No data
Right 914965814 1:152256367-152256389 GGGGCAGCTGCCGGGCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965814 Original CRISPR GGGGCAGCTGCCGGGCGGAG GGG Intergenic