ID: 914965816

View in Genome Browser
Species Human (GRCh38)
Location 1:152256386-152256408
Sequence GGGGCTCCTCACTTCTCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19549
Summary {0: 1678, 1: 2039, 2: 4785, 3: 5902, 4: 5145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965808_914965816 11 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965816 1:152256386-152256408 GGGGCTCCTCACTTCTCAGACGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145
914965804_914965816 26 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965816 1:152256386-152256408 GGGGCTCCTCACTTCTCAGACGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965816 Original CRISPR GGGGCTCCTCACTTCTCAGA CGG Intergenic
Too many off-targets to display for this crispr