ID: 914965817

View in Genome Browser
Species Human (GRCh38)
Location 1:152256387-152256409
Sequence GGGCTCCTCACTTCTCAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20452
Summary {0: 1555, 1: 1910, 2: 1784, 3: 7700, 4: 7503}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965804_914965817 27 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965817 1:152256387-152256409 GGGCTCCTCACTTCTCAGACGGG 0: 1555
1: 1910
2: 1784
3: 7700
4: 7503
914965808_914965817 12 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965817 1:152256387-152256409 GGGCTCCTCACTTCTCAGACGGG 0: 1555
1: 1910
2: 1784
3: 7700
4: 7503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965817 Original CRISPR GGGCTCCTCACTTCTCAGAC GGG Intergenic
Too many off-targets to display for this crispr