ID: 914965818

View in Genome Browser
Species Human (GRCh38)
Location 1:152256388-152256410
Sequence GGCTCCTCACTTCTCAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19883
Summary {0: 1649, 1: 1802, 2: 3083, 3: 7973, 4: 5376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965804_914965818 28 Left 914965804 1:152256337-152256359 CCGGGTGGAGGGGCTCCTCACTT 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
Right 914965818 1:152256388-152256410 GGCTCCTCACTTCTCAGACGGGG 0: 1649
1: 1802
2: 3083
3: 7973
4: 5376
914965808_914965818 13 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965818 1:152256388-152256410 GGCTCCTCACTTCTCAGACGGGG 0: 1649
1: 1802
2: 3083
3: 7973
4: 5376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965818 Original CRISPR GGCTCCTCACTTCTCAGACG GGG Intergenic
Too many off-targets to display for this crispr