ID: 914965819

View in Genome Browser
Species Human (GRCh38)
Location 1:152256391-152256413
Sequence TCCTCACTTCTCAGACGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21214
Summary {0: 2126, 1: 3475, 2: 3747, 3: 6550, 4: 5316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914965815_914965819 -9 Left 914965815 1:152256377-152256399 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 914965819 1:152256391-152256413 TCCTCACTTCTCAGACGGGGCGG 0: 2126
1: 3475
2: 3747
3: 6550
4: 5316
914965808_914965819 16 Left 914965808 1:152256352-152256374 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 914965819 1:152256391-152256413 TCCTCACTTCTCAGACGGGGCGG 0: 2126
1: 3475
2: 3747
3: 6550
4: 5316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914965819 Original CRISPR TCCTCACTTCTCAGACGGGG CGG Intergenic
Too many off-targets to display for this crispr