ID: 914967268

View in Genome Browser
Species Human (GRCh38)
Location 1:152271139-152271161
Sequence ATAGTTCTGCAGGGCAACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914967265_914967268 21 Left 914967265 1:152271095-152271117 CCTGAGACTGGGTGATTTATAAA 0: 229
1: 7063
2: 13618
3: 14430
4: 11819
Right 914967268 1:152271139-152271161 ATAGTTCTGCAGGGCAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914967268 Original CRISPR ATAGTTCTGCAGGGCAACAT AGG Intergenic
No off target data available for this crispr