ID: 914969100

View in Genome Browser
Species Human (GRCh38)
Location 1:152290974-152290996
Sequence ATAGTTCTGCAGGGCAACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914969100_914969103 21 Left 914969100 1:152290974-152290996 CCTATGTTGCCCTGCAGAACTAT No data
Right 914969103 1:152291018-152291040 TTTATAAATCACCCAGTCTCAGG 0: 229
1: 7063
2: 13618
3: 14430
4: 11819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914969100 Original CRISPR ATAGTTCTGCAGGGCAACAT AGG (reversed) Intergenic
No off target data available for this crispr