ID: 914970103

View in Genome Browser
Species Human (GRCh38)
Location 1:152301342-152301364
Sequence AATAATACCCAATAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914970103_914970106 10 Left 914970103 1:152301342-152301364 CCCTGCACCTATTGGGTATTATT 0: 1
1: 0
2: 0
3: 12
4: 131
Right 914970106 1:152301375-152301397 CAATCAGTGTCACTTTATCTTGG 0: 1
1: 0
2: 2
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914970103 Original CRISPR AATAATACCCAATAGGTGCA GGG (reversed) Intergenic
902153789 1:14466526-14466548 AAAAATACCTAATATGTGCTGGG + Intergenic
909402849 1:75253504-75253526 ATTAATACACAATATGTACAAGG + Intronic
909952184 1:81733867-81733889 AAAAATAACTAATAGGTACAAGG + Intronic
914447778 1:147764472-147764494 AACAGTACCAAAGAGGTGCAAGG + Intronic
914970103 1:152301342-152301364 AATAATACCCAATAGGTGCAGGG - Intergenic
916279623 1:163035332-163035354 ATTAATACCCATTATGTGAAAGG + Intergenic
916681924 1:167112773-167112795 AATAATACCTAATTTGTGGAGGG + Intronic
922064109 1:222119780-222119802 AATAATACCAAATATTTGCAAGG + Intergenic
1064582041 10:16804566-16804588 AATATCATCCAATAGGTGAATGG + Intronic
1065227517 10:23559556-23559578 GAATATACCCACTAGGTGCAAGG - Intergenic
1065280672 10:24134555-24134577 ATTAATACCCAATACCTCCATGG - Intronic
1065800780 10:29349898-29349920 AAGAATAACCAATTGATGCAGGG + Intergenic
1068216929 10:53993108-53993130 AGTAATACCTAATATATGCAGGG + Intronic
1068650794 10:59520324-59520346 AATACTACCTAATCGGTACAAGG - Intergenic
1068846985 10:61688037-61688059 AAGAATACCTAATAGATGCTGGG + Intronic
1069207160 10:65705088-65705110 AATATTAATCAATAGGTGAATGG - Intergenic
1071895918 10:90066837-90066859 AATAATAACCAATATGTATAGGG - Intergenic
1079513485 11:21238776-21238798 TATTATAACCATTAGGTGCATGG + Intronic
1079926503 11:26499935-26499957 AATAATTCCTAACAGGTACAGGG - Intronic
1083013797 11:59430072-59430094 GATAAAAACCAATAGGTGCTTGG - Intergenic
1084739868 11:71132739-71132761 AATAATAACCAATATGATCAAGG + Intronic
1085299061 11:75447989-75448011 AATAATACCCACCACATGCAGGG + Intronic
1087135661 11:94716422-94716444 AATAATACCCAAAATGTCCAGGG - Intronic
1087194801 11:95294582-95294604 AATAACACACAAGGGGTGCATGG - Intergenic
1087531971 11:99394652-99394674 AAGAATAACCAATGGGTGCTAGG - Intronic
1087575106 11:99980020-99980042 AATAATACCCAATACTTATATGG - Intronic
1090950963 11:131473033-131473055 AATAATAGCCAATATTTCCAGGG + Intronic
1093110238 12:15143517-15143539 ACTAATACCTACTATGTGCATGG + Intronic
1094466614 12:30760585-30760607 AAAAATGACCAATAGGTACATGG + Intergenic
1098192293 12:67962357-67962379 GCTAATCCCCAAGAGGTGCAAGG - Intergenic
1099588732 12:84556572-84556594 AATAAAAGCCAATAAGTACATGG - Intergenic
1099757964 12:86879573-86879595 AAAAATAACCAATAGGTGCTAGG + Intergenic
1101170046 12:102082119-102082141 AATAAGACTCAATAGGAGCTAGG - Intronic
1105400656 13:20091731-20091753 ATTAACACCTAATAGGTGCTAGG - Exonic
1107018286 13:35726334-35726356 AATAATGCCCCACAGGTGTAAGG - Intergenic
1107307857 13:39041988-39042010 AATAATAACAAATAGGTGATAGG - Intronic
1107892189 13:44923847-44923869 AATAATCTTCAATAGGTCCATGG + Intergenic
1109796237 13:67317035-67317057 AATAATAGCTAATAGATGCTGGG - Intergenic
1111343651 13:86920513-86920535 AAAAAGCACCAATAGGTGCAGGG + Intergenic
1111919096 13:94392054-94392076 CATAATAACCAAAAGGTGAAAGG - Intronic
1114927706 14:27424642-27424664 AATAATAAAAAATATGTGCATGG + Intergenic
1117369324 14:55062522-55062544 AATAGTAACCTATAGGGGCAGGG - Intronic
1117716200 14:58584093-58584115 ACTTGTACCCAATATGTGCAAGG + Intergenic
1118124186 14:62881510-62881532 AGAAATAACCAATAGGTGCCTGG + Intronic
1118896771 14:69952001-69952023 AATAAAACCCTAAAGGTGAAGGG - Intronic
1119946115 14:78696350-78696372 AATAGTAACCAATATATGCAAGG + Intronic
1127496171 15:59514105-59514127 AAAAATAGCTAATAGATGCAGGG + Intronic
1129032117 15:72626771-72626793 AATACTCCCCCATAGGTGAATGG - Intergenic
1129217780 15:74110460-74110482 AATATCCCCCAATAGGTGAATGG + Intronic
1129406885 15:75325509-75325531 AATACTCCCCAATAGGTGAATGG - Intergenic
1129470086 15:75748377-75748399 AATACTCCCCAATAGGTGAATGG - Intergenic
1129734937 15:77954761-77954783 AATACTCCCCAATAGGTGAATGG + Intergenic
1130571682 15:85051584-85051606 AAGAATAGCTAATAGGTGCTGGG - Intronic
1133994981 16:10741274-10741296 AATAAAATCCAATAGGCACAAGG + Intergenic
1136182241 16:28561547-28561569 AAAAAAACACAAAAGGTGCAGGG + Intronic
1138252691 16:55515707-55515729 AATAATAGCAAATAGGAGAAAGG + Intronic
1138622107 16:58219840-58219862 AAAAATATCCAAGAGGTCCAAGG + Intergenic
1139142333 16:64281742-64281764 AATAATGGCCAATAGGTACATGG + Intergenic
1151378095 17:73705386-73705408 ACCAATACCCAATAGGACCAAGG + Intergenic
1153360859 18:4195503-4195525 AATAACACCCGATAGTTGAATGG - Intronic
1154053728 18:10990499-10990521 ATTAATACCCCAAAGCTGCATGG - Intronic
1154345390 18:13539577-13539599 ATAAATACTAAATAGGTGCATGG - Intronic
1159475179 18:68911784-68911806 AAAAATACCTAATAGGTACTAGG + Intronic
1164078858 19:21845384-21845406 AACAATACCCAAAATATGCAAGG + Intronic
1164170376 19:22719815-22719837 AACAATGCCCAATATGAGCAGGG + Intergenic
1166743959 19:45131058-45131080 AATGGTACCCAAGAGATGCAAGG - Intronic
1168592203 19:57646701-57646723 AAAGAGACCCAATAGGTGCTTGG - Intergenic
927952528 2:27182238-27182260 AATAATACCCAACAGGTTTTGGG - Intergenic
930883847 2:56301840-56301862 ACAAATACCTAATACGTGCAGGG + Intronic
933188841 2:79310544-79310566 AACAACACCCAATAAGTGCATGG - Intronic
933706593 2:85295494-85295516 AATAATACCCAAAAGTGGCCAGG - Intronic
938654207 2:133414021-133414043 AATGATACCTATTATGTGCAAGG - Intronic
940432686 2:153611813-153611835 ACAAATACCTAATACGTGCAGGG - Intergenic
1172317852 20:33970221-33970243 AATAAGTCCCGATAAGTGCAAGG + Intergenic
1177522519 21:22245842-22245864 AATTATAACCATTAGTTGCATGG + Intergenic
1177779123 21:25604279-25604301 AATAATACCCAATATACTCAAGG + Intronic
1182025109 22:27111762-27111784 TAAAATACCAATTAGGTGCATGG + Intergenic
1183458416 22:37935230-37935252 AATAATAACAAATAGGGCCAGGG - Intronic
1184383323 22:44160166-44160188 AATGATGACCAATGGGTGCAAGG - Intronic
951403432 3:22263808-22263830 AGTAATACCCACTAGATGCCAGG - Intronic
952501272 3:33964466-33964488 AAAAATACCCAAAAGGAGGATGG + Intergenic
957279954 3:78137598-78137620 ACTAATAGTCAATATGTGCAAGG - Intergenic
957411223 3:79843149-79843171 AATAATACCAGATAGGTACTTGG + Intergenic
958682320 3:97346842-97346864 AAAAATACCTCATATGTGCATGG - Intronic
959634058 3:108542662-108542684 AAGAATAGCTAATAGGTGCTGGG - Intergenic
960345391 3:116524078-116524100 AATAATAACAAATAAGTTCATGG - Intronic
962885781 3:139625763-139625785 AATAATACCAAACAGAAGCATGG - Intronic
967788918 3:193526487-193526509 ACAAATACCTAATACGTGCAGGG + Intronic
970337341 4:15062151-15062173 TAAAATACCCAAAAGGTGCTGGG + Exonic
972944502 4:44237400-44237422 AATAATAACCCATAGGGTCATGG - Intronic
973685892 4:53369596-53369618 AATAATTCCCTAAAGGTGTATGG + Intergenic
976387010 4:84471861-84471883 AATAATAATCCATAGGTTCAAGG + Intergenic
977505440 4:97897015-97897037 AATAATAACTAATAGGTACTAGG - Intronic
977693585 4:99944451-99944473 CATAATAGCCAAGAGGTGAAAGG + Intronic
979433641 4:120662850-120662872 AAAAATACCTAATAGGTACTAGG - Intergenic
981625035 4:146745593-146745615 CTTAATACTCAATAGGTGGACGG + Intronic
984135731 4:175935843-175935865 AATAATAATCAAAAAGTGCAAGG + Intronic
984773514 4:183459387-183459409 AATACTACACATTAGGTGCAAGG - Intergenic
986621348 5:9678809-9678831 AATAATAGCCAATGGATGCTGGG + Intronic
989008290 5:36840195-36840217 AATAATATCCAGTATGTACAAGG - Intergenic
989206973 5:38819200-38819222 AAAAATAACCAATAGGTACTAGG + Intergenic
991401322 5:66254765-66254787 AATTATACCTCATATGTGCATGG - Intergenic
992344608 5:75864366-75864388 AATAGTACCTAATAGGTACCAGG + Intergenic
993030564 5:82700690-82700712 AATAATGCACAATAGATGCCTGG - Intergenic
995335459 5:110993335-110993357 AATAATAACTAATAGGTACTAGG + Intergenic
997680907 5:135750057-135750079 AATAAAATCCAATAGGCACAAGG - Intergenic
998384901 5:141751450-141751472 ATTAATAACCATTAGGTGAATGG + Intergenic
1001829494 5:174773703-174773725 GATATTACACATTAGGTGCATGG - Intergenic
1002651292 5:180697623-180697645 AAAAATAACCAATAGGTACTGGG + Intergenic
1003005690 6:2379171-2379193 AATAGAACCTAATGGGTGCAAGG + Intergenic
1004959779 6:20774007-20774029 AATAAAACCAAATTTGTGCAAGG + Intronic
1005260449 6:24053207-24053229 AATGAAAACCAAAAGGTGCAGGG - Intergenic
1005822640 6:29610315-29610337 AATACTACCTATTAGGTACAAGG + Intronic
1010386865 6:75290198-75290220 AATACTACACAGTAAGTGCAAGG - Intergenic
1017923919 6:158894683-158894705 AAAACTACCCAATATATGCATGG + Intronic
1020546368 7:9537376-9537398 AAGAATACCTTATAGGTGAAAGG - Intergenic
1021530956 7:21644423-21644445 AAAAAGACTCAATACGTGCATGG + Intronic
1022031445 7:26494874-26494896 AATAATGCCCAATAGGTAAATGG + Intergenic
1023232121 7:38044581-38044603 ATAAATACCCAGTAGTTGCATGG + Intergenic
1024148117 7:46537737-46537759 AATGATACCCCATTGGTTCAAGG - Intergenic
1026603481 7:71796215-71796237 TATAGTACCCAAAAGGTGGAAGG - Intronic
1028858445 7:95618869-95618891 AAAAATAACTAATGGGTGCAAGG + Intergenic
1031358194 7:120814651-120814673 AATAATACCCAGTGAGTGCAAGG + Intronic
1035409674 7:158629373-158629395 AATAACCCTCAATAGGTGAATGG + Intergenic
1041331017 8:56725229-56725251 AATAATGGCCTACAGGTGCAAGG - Intergenic
1044547379 8:93474814-93474836 ATGAATACACAAAAGGTGCAAGG - Intergenic
1044654690 8:94535332-94535354 ATTAAACCCCAATAGGTACAGGG + Intronic
1047438762 8:124857848-124857870 AATAATTCCCAATATGTGCCAGG - Intergenic
1048307711 8:133295750-133295772 TATAATACCCATCAGCTGCACGG - Intronic
1055213777 9:73833631-73833653 AATAATAAACAATAGGGTCAAGG + Intergenic
1057247098 9:93465978-93466000 AAGAATAGCCCAGAGGTGCAGGG + Intronic
1057846327 9:98528779-98528801 AATAATACACAATACTGGCAGGG + Intronic
1058262220 9:102848819-102848841 AATAAAACCCAAGATGTGCCAGG - Intergenic
1188851049 X:35132641-35132663 AATAATACCTAATGGATGCTGGG - Intergenic
1188860908 X:35254437-35254459 AATATTACTCAATAGGTGACTGG + Intergenic
1192566208 X:72165753-72165775 AAGAATACCAAATTGATGCACGG + Intergenic
1194011822 X:88570699-88570721 AATAAGACCCATTGGGTCCAGGG - Intergenic
1195067283 X:101249001-101249023 AATAATACCCAATATCTGGGAGG + Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1198796277 X:140399315-140399337 AATAATACCAAATACATGCTCGG + Intergenic
1199068198 X:143445045-143445067 AATAATAGCTAATTGGTGCTTGG - Intergenic
1199437758 X:147832147-147832169 AAAAATACCTAATGCGTGCAGGG + Intergenic
1199752309 X:150831630-150831652 AAAAATAACCAATGGGTGCTAGG + Intronic
1201144659 Y:11057579-11057601 AATAATAACCAATATGATCAAGG + Intergenic