ID: 914972703

View in Genome Browser
Species Human (GRCh38)
Location 1:152325264-152325286
Sequence TTTATAGCAGGCCCCATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914972695_914972703 21 Left 914972695 1:152325220-152325242 CCTGAAGGAGCCTGCTGGGTACT 0: 1
1: 0
2: 0
3: 15
4: 148
Right 914972703 1:152325264-152325286 TTTATAGCAGGCCCCATGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 114
914972697_914972703 11 Left 914972697 1:152325230-152325252 CCTGCTGGGTACTGAAGGCTGAG 0: 1
1: 0
2: 2
3: 18
4: 191
Right 914972703 1:152325264-152325286 TTTATAGCAGGCCCCATGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914972703 Original CRISPR TTTATAGCAGGCCCCATGCA GGG Intergenic
900034938 1:399876-399898 TTTATTGCAGGCAGCAAGCAAGG + Intergenic
900056555 1:635628-635650 TTTATTGCAGGCAGCAAGCAAGG + Intergenic
902876690 1:19344684-19344706 TTTAGAGCAGCTCCCAGGCATGG - Intronic
905010862 1:34746208-34746230 TTTAAAGCTTGCCCCATGAAGGG - Intronic
906244382 1:44262783-44262805 TTTAGAGCAGGTCCCATCTAGGG + Intronic
906250808 1:44309539-44309561 TTTACAGAAGACCCCAGGCATGG + Intronic
910769894 1:90820372-90820394 TATATAGCAGGCACCATTCTGGG - Intergenic
911822548 1:102439390-102439412 TTTATAGAAGTCCCCAGCCATGG - Intergenic
914972703 1:152325264-152325286 TTTATAGCAGGCCCCATGCAGGG + Intergenic
916579425 1:166094326-166094348 TTTATAGCTGTCCCAAAGCAGGG - Intronic
917224384 1:172765990-172766012 TTTATAGCAAGGCCCAGGAAAGG - Intergenic
922257465 1:223905433-223905455 TTTATTGCAGGCAGCAAGCAAGG + Intergenic
924222313 1:241890602-241890624 TTTATAACAGGAAACATGCATGG - Intronic
924338661 1:243008213-243008235 TTTATTGCAGGCAGCAAGCAAGG + Intergenic
924833772 1:247628049-247628071 TTTATAGCAGGCCACGAGCCAGG - Intergenic
1065416489 10:25493212-25493234 GTTGAAGCAGGCCCCATGCTAGG - Intronic
1069055153 10:63837126-63837148 ATTATACCAGGCCCCATGCTAGG - Intergenic
1073935904 10:108631532-108631554 TCTAGAGCAGGAACCATGCATGG - Intergenic
1078626809 11:12965359-12965381 TATATGGAAGACCCCATGCAGGG - Intergenic
1078652454 11:13208160-13208182 TATTTGTCAGGCCCCATGCAAGG - Intergenic
1078778804 11:14417874-14417896 AGTAGAGCAGGCCCCAGGCATGG - Intergenic
1087146938 11:94821922-94821944 TTTATACTAGGCCCTGTGCAAGG + Intronic
1089912679 11:122118065-122118087 TATATACCAGGCACCATACAAGG + Intergenic
1093685604 12:22050171-22050193 TTTAGTGCATGCCCTATGCAGGG + Intronic
1099123954 12:78729202-78729224 TATATACCAGGCTTCATGCATGG + Intergenic
1099842689 12:87985890-87985912 TTTATTGTAGGACCCATGCGTGG + Exonic
1101256616 12:102984111-102984133 TTTATAGGATGTTCCATGCATGG + Intergenic
1102312857 12:111860581-111860603 TTCATAGCTGGCCCCATGTTGGG + Intronic
1102713727 12:114952060-114952082 ATTATAGCAGCCCGAATGCAGGG + Intergenic
1103012147 12:117465804-117465826 TTTGTATCAGGTCACATGCAGGG + Exonic
1106343357 13:28852358-28852380 TGTATACCAGACCCCATCCAAGG - Intronic
1106584877 13:31048364-31048386 TGAATGACAGGCCCCATGCATGG + Intergenic
1112159604 13:96853801-96853823 TTTATAGCAGGCACAAGGGATGG - Intergenic
1113592911 13:111513222-111513244 CTTATAGGAGCCCCCAAGCAGGG + Intergenic
1115803777 14:37027618-37027640 TTTATAGCAGGCAGCAAACAAGG + Intronic
1119929267 14:78528938-78528960 TGTATAGCAGGCACAATGCTAGG + Intronic
1120424460 14:84329556-84329578 GACATAGCAGGCCCCATGAAAGG - Intergenic
1125878915 15:43175473-43175495 TTTATGGCCAGCCACATGCATGG + Intronic
1127776498 15:62268034-62268056 TTTACAGCAGGCCCCTTACTAGG + Intergenic
1129340741 15:74884741-74884763 TTTATTGCAGGTGCCAAGCAAGG + Intergenic
1129838560 15:78729327-78729349 TTTACAGCAGGCCACATACTAGG - Intergenic
1129873627 15:78957715-78957737 TTTGTATCAGGCCCCATTCCAGG - Intergenic
1130319398 15:82828122-82828144 TGTATACCAGGCACCATGCTAGG + Intronic
1130417502 15:83707275-83707297 TATGTACCAGGCCCTATGCAGGG - Intronic
1131398560 15:92106370-92106392 CTTCCAGCAGGCCCCAGGCAAGG + Intronic
1133719031 16:8477140-8477162 TGAATACCAGGCCCCATGCAAGG + Intergenic
1137668399 16:50265426-50265448 TCTGTGCCAGGCCCCATGCAGGG - Intronic
1140815867 16:78620328-78620350 TTGATAGGAGGCACAATGCAGGG - Intronic
1141289683 16:82706210-82706232 TATATACCAGGCACGATGCAAGG + Intronic
1145250661 17:21295352-21295374 CTCATAGCAGCCCCCAGGCAGGG - Intronic
1146075514 17:29725001-29725023 TATGTAGCAGGTCCCATTCAAGG + Intronic
1146553999 17:33807379-33807401 CTTATGGCAGGCCCCATGCTGGG + Intronic
1146583060 17:34057122-34057144 TTTATGCCAGGCCCCATACTTGG + Intronic
1148210927 17:45808105-45808127 TACACAGCAGGCCCCACGCAGGG + Intronic
1148892456 17:50817944-50817966 TTTATAGAACGCCCTATGCCAGG + Intergenic
1151183201 17:72344473-72344495 TGTATAGCAGGCGCTATGCTAGG - Intergenic
1156206481 18:34891495-34891517 TTTAAAGCAGGACCCATTGATGG + Intronic
1157319207 18:46621289-46621311 TTTTTAGAAGTCCCCATACATGG + Intronic
1162049233 19:8022371-8022393 TTTAAAGCAGGCACCGAGCAGGG + Intronic
1162304574 19:9864090-9864112 TTTTCTGCTGGCCCCATGCAAGG - Intronic
1163504739 19:17698899-17698921 TTTCTAGCAGCCCCAATCCAAGG + Intergenic
1166328333 19:42064914-42064936 TTAATAACAAGCCCCAGGCATGG - Intronic
925071643 2:973798-973820 TGTCTAGCAAGCCCCATGGAAGG + Intronic
926972897 2:18484595-18484617 ATGATAGCAGGCCCCATGCTAGG + Intergenic
927250706 2:20992887-20992909 ATTGTGGCTGGCCCCATGCAAGG + Intergenic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
930677936 2:54224425-54224447 TCCATAGAAGGCCCCATGCCTGG - Intronic
932747243 2:74344133-74344155 CATATACCAGGCCCCATGCTGGG - Intronic
935675691 2:105593459-105593481 TATATAGCATGCCACATGCTTGG + Intergenic
942993881 2:182237519-182237541 TTTATACCAGGCACTCTGCAAGG + Intronic
946115546 2:217458813-217458835 TTTATGTCAGGCCACATGTAAGG + Intronic
1169719174 20:8654463-8654485 TATATACCAGGCACCATGCTGGG + Intronic
1172458161 20:35093651-35093673 TTTATTACAGGCCCCCTGCTAGG - Intergenic
1174338417 20:49881076-49881098 TTAAAAGCACGCCCCATACAGGG + Intronic
1174775418 20:53339260-53339282 CTAATACCAGGCCCTATGCAGGG + Intronic
1177193896 21:17882111-17882133 GATATACCAGGCCCCATGTAAGG + Intergenic
1181553717 22:23655526-23655548 TTTATAATAGGCCCCAGGCCAGG - Intergenic
1184985892 22:48133948-48133970 TTTATAGAAGGCCCAAAGGAAGG - Intergenic
950023565 3:9805929-9805951 TTTCTAGCAGCCTCCATGCCAGG + Intronic
950185175 3:10940292-10940314 TTCCCAGCAGGCCCCAGGCAAGG + Exonic
966502647 3:180661595-180661617 TTTATAACAGGCAGCAAGCATGG + Intronic
969247867 4:5947303-5947325 TTTATATCAAGCCCCCAGCAGGG + Intronic
969641581 4:8402013-8402035 AGTCTGGCAGGCCCCATGCACGG - Intronic
979238459 4:118427026-118427048 TTTATTGCAGGCAGCAAGCAAGG - Intergenic
991426968 5:66502290-66502312 TTGATACCAAGCCCCAAGCAAGG - Intergenic
994299692 5:98132695-98132717 TTTATACCAGGCACATTGCAGGG - Intergenic
997438651 5:133893113-133893135 TTCAGAACATGCCCCATGCAGGG + Intergenic
998389299 5:141776992-141777014 TATATAACAGGCACCATGCTGGG + Intergenic
1001976640 5:176005783-176005805 TTTATGGCTGGCTGCATGCAGGG - Intronic
1002240786 5:177837989-177838011 TTTATGGCTGGCTGCATGCAGGG + Intergenic
1002738881 5:181418995-181419017 TTTATTGCAGGCAGCAAGCAAGG - Intergenic
1003518324 6:6836033-6836055 TGTAGGCCAGGCCCCATGCAAGG - Intergenic
1006463329 6:34176727-34176749 TTGCTATCAGGCCCCATGCCCGG + Intergenic
1010588080 6:77679636-77679658 TTTGTAGCAAGCACCATTCACGG - Intergenic
1012958144 6:105592758-105592780 TGTATAGCAGGCACCTTGCTGGG + Intergenic
1013774620 6:113665840-113665862 CTTACAGCAGGTCCCAAGCATGG + Intergenic
1016307831 6:142701958-142701980 TTTATAGCAGTCACAATTCATGG - Intergenic
1018148588 6:160917697-160917719 TTGATTGCAGGCCTCATGCTGGG - Intergenic
1019243989 6:170694547-170694569 TTTATTGCAGGCAGCAAGCAAGG - Intergenic
1021877201 7:25059966-25059988 TCTCTAGCAGGTGCCATGCAAGG - Intergenic
1022281853 7:28919168-28919190 TTGATGGCAGGTCCCATACATGG + Intergenic
1025019848 7:55472445-55472467 TTAATAGGAAGCCCCATGCCGGG - Exonic
1035504136 8:113613-113635 TTTATTGCAGGCAGCAAGCAAGG + Intergenic
1036045776 8:5138494-5138516 TTTATATCAGGCCTGAGGCATGG + Intergenic
1040878516 8:52177594-52177616 GTAATGGCAGGCCCCATGCCTGG - Intronic
1042611049 8:70601576-70601598 TATGTACCAGGCCCCATGCTGGG - Intronic
1044975702 8:97663350-97663372 AATATGGCAGGCACCATGCAAGG + Intronic
1046821274 8:118636809-118636831 TTTATAGAGGGACCCATTCAGGG + Intergenic
1047116279 8:121844941-121844963 TATATAGAATGCCTCATGCAGGG - Intergenic
1053519439 9:38763213-38763235 TTTATTGCAGGGGCCAAGCAAGG - Intergenic
1054786189 9:69212538-69212560 TTTAAAACAGGCCCCAGGCATGG + Exonic
1056617886 9:88184166-88184188 TTTAGAGCAGACCCCAAGCCCGG + Intergenic
1059300362 9:113307714-113307736 TGTTTAGCAGGCCCCAGTCAAGG + Intergenic
1059956998 9:119526901-119526923 TTTATAGATAGCCTCATGCACGG + Intergenic
1203604178 Un_KI270748v1:43771-43793 TTTATTGCAGGCAGCAAGCAAGG - Intergenic
1185764032 X:2710083-2710105 TATATAGCAGTCCTCATGCTAGG + Intronic
1186843311 X:13506631-13506653 TTAATAGCAAGTCCCAGGCAGGG - Intergenic
1202386234 Y:24328818-24328840 TTTATTGCAGGCAGCAAGCAAGG - Intergenic
1202484552 Y:25341310-25341332 TTTATTGCAGGCAGCAAGCAAGG + Intergenic