ID: 914973097

View in Genome Browser
Species Human (GRCh38)
Location 1:152329296-152329318
Sequence CTGTAGGAGTGAAGGGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914973090_914973097 0 Left 914973090 1:152329273-152329295 CCCTTTGAGATGTGTGACTGAGG No data
Right 914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG No data
914973092_914973097 -1 Left 914973092 1:152329274-152329296 CCTTTGAGATGTGTGACTGAGGC No data
Right 914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914973097 Original CRISPR CTGTAGGAGTGAAGGGGAGT TGG Intergenic
No off target data available for this crispr