ID: 914974896

View in Genome Browser
Species Human (GRCh38)
Location 1:152352283-152352305
Sequence CTCCATGTTGAGATCCAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914974895_914974896 8 Left 914974895 1:152352252-152352274 CCATGTCTCTCGTCAACTATGGA 0: 1
1: 0
2: 1
3: 6
4: 92
Right 914974896 1:152352283-152352305 CTCCATGTTGAGATCCAGCCTGG 0: 1
1: 1
2: 2
3: 13
4: 162
914974892_914974896 29 Left 914974892 1:152352231-152352253 CCTGTCTGTCCATGAGTAGTTCC 0: 5
1: 3
2: 5
3: 4
4: 79
Right 914974896 1:152352283-152352305 CTCCATGTTGAGATCCAGCCTGG 0: 1
1: 1
2: 2
3: 13
4: 162
914974893_914974896 20 Left 914974893 1:152352240-152352262 CCATGAGTAGTTCCATGTCTCTC 0: 2
1: 3
2: 4
3: 17
4: 142
Right 914974896 1:152352283-152352305 CTCCATGTTGAGATCCAGCCTGG 0: 1
1: 1
2: 2
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914974896 Original CRISPR CTCCATGTTGAGATCCAGCC TGG Exonic
900301253 1:1978571-1978593 CTCCATCTTCAAAACCAGCCAGG - Intronic
900744298 1:4350895-4350917 CTCGATGGTGAGATGCTGCCTGG - Intergenic
901267413 1:7922273-7922295 CTCCATTTTGAAATTCAACCTGG - Intronic
901876551 1:12169970-12169992 CTCCTCTTTGACATCCAGCCTGG - Intronic
903164660 1:21511688-21511710 CTCCATGATGAGATCAGCCCTGG + Intronic
903668003 1:25019461-25019483 CTCCAAGTTGTGAGCCCGCCTGG - Intergenic
903934215 1:26883740-26883762 CGCCATTGTGCGATCCAGCCTGG + Intronic
904692198 1:32301815-32301837 TTAAATGTTGAGACCCAGCCTGG + Intronic
905097432 1:35485835-35485857 CACTATGTTGAGTTCCAGGCTGG + Intronic
906298232 1:44662246-44662268 CTCCAGGCTGAGTTGCAGCCAGG - Intronic
908357123 1:63333431-63333453 CTCTTTGCTGAGATCCAGTCTGG + Intergenic
908820349 1:68079024-68079046 AACCACGTTGAGATCCAGCAAGG - Intergenic
910974185 1:92888603-92888625 CTCCATGTTGAGTTCCATAATGG + Intronic
911154012 1:94621910-94621932 TTCCAAGTTCAGATCCAACCAGG + Intergenic
914974720 1:152350933-152350955 GTCTTTGTTGAGATCCAGCTTGG + Exonic
914974755 1:152351158-152351180 GTCCATGTCGAGATCCGGCTTGG + Exonic
914974783 1:152351383-152351405 CTCCATGTTGAGATCTGGCTTGG + Exonic
914974810 1:152351608-152351630 CTCCATGTTGAGATCCGGCTTGG + Exonic
914974872 1:152352058-152352080 CTCCATGTTGAGACCTGGCTTGG + Exonic
914974896 1:152352283-152352305 CTCCATGTTGAGATCCAGCCTGG + Exonic
914974928 1:152352514-152352536 CTCCATGTTGAGATCTGGCTTGG + Exonic
914974981 1:152352964-152352986 CTTCATGTTGAGATCCGGCTTGG + Exonic
914975003 1:152353195-152353217 CTCCATGTTGAGATCCACTTTGG + Exonic
914975035 1:152353420-152353442 CTCCATGTTGAGATCCGGCTTGG + Exonic
914975066 1:152353651-152353673 CTCCATGTTGAGATCCAGCTTGG + Exonic
914975109 1:152354107-152354129 CTACTTGTTGAGATTCACCCTGG + Exonic
920558935 1:206925220-206925242 CCCCATGGTGTGCTCCAGCCTGG - Intergenic
922967436 1:229702687-229702709 CTCCAGCTTGGGTTCCAGCCTGG + Intergenic
923773489 1:236958288-236958310 CTCAGTGTTGAGATCCTTCCTGG - Intergenic
1064130867 10:12708459-12708481 TTCTATATTGAGATCCAGCTGGG - Intronic
1065204314 10:23343350-23343372 CACCATGTGGAGACACAGCCAGG + Intronic
1065968970 10:30791021-30791043 CTCCATGTTGAGTCCCACCTAGG + Intergenic
1068526919 10:58140892-58140914 CTTCATTGTGAGATGCAGCCAGG + Intergenic
1069440591 10:68424879-68424901 ATCCTTGTTGAGATTTAGCCTGG - Intronic
1070526168 10:77297850-77297872 CTCCATCTTGGAATCCAGGCAGG - Intronic
1071051120 10:81450245-81450267 CTGAAAGTTGAGACCCAGCCAGG - Intergenic
1071109303 10:82136374-82136396 CAGCATGTGGAAATCCAGCCAGG + Intronic
1071367666 10:84916314-84916336 CTCCAAATTGAGAGCCATCCAGG - Intergenic
1071802274 10:89076848-89076870 CCCCATGAGGAGATGCAGCCTGG + Intergenic
1073494953 10:103882425-103882447 CTCCCTGTTGAGCTCCTGGCTGG - Intergenic
1074702652 10:116106080-116106102 CTCCATTTTCAGAACCAGCAAGG - Intronic
1076717481 10:132373768-132373790 CTCCCTGTGGAGACCCCGCCAGG - Intronic
1077384517 11:2262727-2262749 CTGCCTGTTGTGATCCAGGCAGG - Intergenic
1078141745 11:8698246-8698268 CTCCATCTTCAGCTCCAGGCAGG + Intronic
1080421460 11:32114722-32114744 CTCCATCTAGAGATCCAGAATGG - Intergenic
1080789781 11:35511982-35512004 ACCGAGGTTGAGATCCAGCCAGG - Intronic
1081991082 11:47337998-47338020 CATCCTGTTGAGACCCAGCCTGG - Intronic
1083645281 11:64168596-64168618 CTCCATGTTCAAAGCCAGCGCGG + Intergenic
1083687388 11:64384699-64384721 CTGCAGGTTGAGAGGCAGCCAGG + Intergenic
1084563090 11:69914979-69915001 CTCCATCTTGGGACCCAACCCGG + Intergenic
1087069312 11:94061274-94061296 CCCCATGTTTATCTCCAGCCAGG - Intronic
1090298204 11:125609202-125609224 CTCCAAGTTTATATACAGCCTGG + Intronic
1090912422 11:131133112-131133134 CTCTTTGTTGAAATCCAGACCGG + Intergenic
1090932400 11:131310026-131310048 CTCCATGATGAGATACACTCTGG + Intergenic
1093315797 12:17648110-17648132 ACCCATTTTGAGGTCCAGCCAGG + Intergenic
1093871643 12:24299385-24299407 CTCATTCTTGATATCCAGCCCGG + Intergenic
1094581050 12:31734309-31734331 CAGCCTGTTGTGATCCAGCCAGG + Intergenic
1102219965 12:111187707-111187729 GTCCATGCAGAGCTCCAGCCTGG + Intronic
1102762278 12:115398493-115398515 GTCCCTGTTTAGATCCCGCCAGG - Intergenic
1104064000 12:125291467-125291489 CTCCATCTTCAGAGCCAGCATGG - Intronic
1104818957 12:131664032-131664054 CACCATGGTGAGCTCAAGCCAGG + Intergenic
1113172267 13:107517908-107517930 CGCCATGTTGCACTCCAGCCTGG + Intronic
1118731195 14:68668160-68668182 CTCCATCTTGACATCAACCCTGG + Intronic
1119185223 14:72636507-72636529 CTCCACTTTGAGACCCAGCTTGG + Intronic
1119689972 14:76663911-76663933 CTCCATACTCAGAGCCAGCCAGG + Intergenic
1120280893 14:82436560-82436582 CTCCATCTTGAAATCCAGCAAGG - Intergenic
1121246913 14:92467646-92467668 CTCCATGTTGCCCTCCAGCCAGG + Intronic
1121358672 14:93235316-93235338 CTCCATGGAGAGACCAAGCCTGG - Intergenic
1121922387 14:97894179-97894201 CCCCATGCTGAAATGCAGCCAGG - Intergenic
1122052583 14:99070160-99070182 CTCCATGCTCACATCCAGCATGG + Intergenic
1122596263 14:102894894-102894916 CGCCATGTTGTTATCCAGGCTGG + Intronic
1124955860 15:34359934-34359956 CTCTATGTTGAGACCTAGCTGGG - Intronic
1127399559 15:58572672-58572694 CTCAGTGTAGAGCTCCAGCCTGG + Intergenic
1128704162 15:69826387-69826409 CTCCATTTTCAGACGCAGCCAGG - Intergenic
1130426499 15:83806272-83806294 CTCCAGCTTAAGAACCAGCCTGG + Intronic
1130941466 15:88513093-88513115 CTCAAGTTTGAGATCCAGGCGGG - Exonic
1131466597 15:92660554-92660576 GTCCATCTTGAGTTACAGCCAGG + Intronic
1131652899 15:94421594-94421616 CTCCATCTTCAGATCCAGCAAGG + Intronic
1134365556 16:13574457-13574479 CTCCAAGCTGACATACAGCCAGG + Intergenic
1137608909 16:49805954-49805976 CTCCCTGTTAAGGTCCAGGCAGG - Intronic
1137749014 16:50844855-50844877 CTTCATCTTGAGAACAAGCCTGG + Intergenic
1142160380 16:88554512-88554534 CTCCATCTTCAGAGCCAGCAGGG + Intergenic
1142694376 17:1625277-1625299 CACCGTGTTGGGTTCCAGCCTGG - Intronic
1143425645 17:6834975-6834997 GTCCGTGGTGAGATCCAGGCTGG - Intergenic
1143711023 17:8735480-8735502 CTCCATGTAGCGCGCCAGCCGGG + Exonic
1145924215 17:28633699-28633721 GCCCATGCTGGGATCCAGCCTGG - Exonic
1146594323 17:34156167-34156189 CTGCAGGTTGACATCCAGCAGGG + Intronic
1149987324 17:61357195-61357217 CAACAGTTTGAGATCCAGCCTGG + Intronic
1152366074 17:79857227-79857249 CTCCAGGTTGGGATGGAGCCAGG + Intergenic
1153288805 18:3480619-3480641 CTTCCTGTTGTGCTCCAGCCTGG - Intergenic
1154342496 18:13515847-13515869 CTCCAGGTTGCACTCCAGCCTGG - Intronic
1156964752 18:43077479-43077501 CTTCATGTTGAGTTTAAGCCTGG + Intronic
1160224569 18:77002129-77002151 CTCCATGTGGAGTTGCCGCCTGG + Intronic
1160310026 18:77780491-77780513 CTCCATGCTCACCTCCAGCCCGG + Intergenic
1160537610 18:79603500-79603522 CTCCCCGCTGAGATCCTGCCAGG + Intergenic
1163625671 19:18388181-18388203 CGCCGTGGTGAGATCCAGCTTGG + Intronic
1163786331 19:19276836-19276858 CTCGCTGGTGAGACCCAGCCTGG + Intronic
1168361615 19:55745479-55745501 TTCTTTGTTGAGTTCCAGCCAGG - Intergenic
925609013 2:5688344-5688366 CTCCATGATGAGAGCCACGCGGG + Intergenic
928112936 2:28525232-28525254 CTCAATGTTAACACCCAGCCAGG - Intronic
928128021 2:28629480-28629502 CTCCCTGTTGAGAAGCAGCATGG + Intronic
929715791 2:44308092-44308114 CTCCAGGGTGAACTCCAGCCTGG + Intronic
930439604 2:51390036-51390058 CAGCATGTTTAGATCCAGCCAGG - Intergenic
933408279 2:81890732-81890754 CTGCATATTGAGATTCTGCCTGG + Intergenic
933762264 2:85680531-85680553 CTACAAGTGGAGCTCCAGCCTGG - Intergenic
933799759 2:85951494-85951516 CTCCAGGTTCAAATCCATCCTGG + Intergenic
934578695 2:95420517-95420539 TCCCATGGTGTGATCCAGCCTGG + Intergenic
934600748 2:95656192-95656214 TCCCATGGTGTGATCCAGCCTGG - Intergenic
937368104 2:121279666-121279688 CTCAATTTGGAGAGCCAGCCAGG - Intronic
937444904 2:121949675-121949697 CTCCATCCTGGGAACCAGCCTGG + Intergenic
941528937 2:166640616-166640638 CTCCATGGAGAGATGTAGCCTGG - Intergenic
942102912 2:172603716-172603738 CTCCAGGGTTAGATCCAGGCAGG + Intronic
944666352 2:201962600-201962622 CTCCTTGGGGAGACCCAGCCTGG - Intergenic
946489107 2:220130663-220130685 CACAATGGTGAGATGCAGCCTGG + Intergenic
946656937 2:221958457-221958479 CTCCATGTAGTGATCCACCTGGG - Intergenic
946731386 2:222712834-222712856 CACCATGTTGAAACCCCGCCAGG - Intergenic
946885481 2:224218220-224218242 CTCCATCATGAGAACAAGCCTGG - Intergenic
947633968 2:231670948-231670970 CTACAAGTTCAGATCCAGCCTGG - Intergenic
1172713011 20:36941683-36941705 CTCTCTGTTGACACCCAGCCAGG - Intronic
1175492684 20:59389828-59389850 CCCCCTGGTGAGAACCAGCCTGG - Intergenic
1176037220 20:63045436-63045458 CCCCCTGTTGAGGTCGAGCCTGG + Intergenic
1176291153 21:5045459-5045481 TTTCATCTTGAAATCCAGCCTGG + Intergenic
1178508831 21:33185227-33185249 CTCCATGTTGTGAGGAAGCCAGG + Intergenic
1179866102 21:44218182-44218204 TTTCATCTTGAAATCCAGCCTGG - Intergenic
1179892359 21:44342701-44342723 TTCCATCTTGAAATACAGCCTGG + Intergenic
1184914428 22:47559345-47559367 CTACAGGTAGAGATCCAGCGTGG - Intergenic
950124732 3:10504488-10504510 CTCCATGCAGAGGCCCAGCCTGG - Intronic
951603358 3:24401689-24401711 CTCACTGTGGAGAGCCAGCCTGG - Intronic
953707770 3:45244112-45244134 CTCCAGGTTGAGAGACAGCGGGG + Intergenic
955942249 3:64157714-64157736 CTCCATGCAGAGACACAGCCAGG + Intronic
958728188 3:97931617-97931639 CTTAATGTTGAGATAGAGCCAGG - Intronic
961111736 3:124289898-124289920 CTCCATGTGAATATCCACCCGGG - Intronic
961249848 3:125492460-125492482 CCACATGTTGTGTTCCAGCCTGG - Intronic
962373600 3:134841272-134841294 AGCCATGTTCAGACCCAGCCAGG + Intronic
968127017 3:196167570-196167592 CTCCATGTTGGTCTCCAGGCTGG + Intergenic
972553149 4:40151835-40151857 CTCCAAGATGATATTCAGCCTGG - Intronic
972688231 4:41371503-41371525 CTTGATGCTGAGATCCAGACTGG + Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977270559 4:94912558-94912580 CTCCTTGGTGAGAATCAGCCAGG + Intronic
977870013 4:102080407-102080429 CTCCATATGAAAATCCAGCCTGG - Intergenic
979007322 4:115316321-115316343 CTCCATGATGAGATTCTTCCAGG + Intergenic
982460757 4:155666946-155666968 CACCATGGTGAGATCACGCCCGG - Intronic
986729855 5:10627458-10627480 CTACGTGCTGAGAGCCAGCCTGG + Intronic
986806118 5:11310602-11310624 TTCCATGTTGAGAAACAGCATGG - Intronic
987705088 5:21452832-21452854 CTCCTGGTTGAGAGCCAGACAGG - Intergenic
997228021 5:132224041-132224063 CCCTCTGGTGAGATCCAGCCAGG - Intronic
1002359988 5:178662658-178662680 CTCCATGTTGGCCTCCAGCCCGG + Intergenic
1012037793 6:94165511-94165533 AACCATGTGGAGATCCAGCAAGG + Intergenic
1013297766 6:108774794-108774816 CTCCATTTTTAAAGCCAGCCAGG + Intergenic
1018652485 6:166003702-166003724 CTCCATGGTCAGAGCCTGCCAGG - Intergenic
1022446772 7:30477556-30477578 CGCCCTGTTGCGCTCCAGCCTGG - Intronic
1022794191 7:33719095-33719117 CTCCAAGATGTGATCCAGCCTGG + Intergenic
1027419729 7:78007157-78007179 ATCCATGCTGAGAAACAGCCTGG - Intergenic
1028293664 7:89099884-89099906 CTTCATGTTGATACCCAGACTGG + Intronic
1030035503 7:105405206-105405228 CTCCATGTTGAGCTCAGGTCAGG - Intergenic
1030896761 7:115070550-115070572 CTCCCAGTTGATAGCCAGCCAGG - Intergenic
1035108809 7:156463544-156463566 CTCCAGGGAGAGCTCCAGCCAGG + Intergenic
1035696501 8:1601690-1601712 CTCCATTATGAGACCAAGCCTGG + Intronic
1036681264 8:10876035-10876057 CTCCCTGTTGTGATCCAGACTGG - Intergenic
1038349490 8:26763175-26763197 CTCCTTGGTGAGCTCCAGGCAGG + Intronic
1041902984 8:63002468-63002490 CCCCATGGTGAGCTCCAGCCTGG - Intergenic
1045722871 8:105134096-105134118 CCACATGTTTAGATTCAGCCAGG - Intronic
1055420330 9:76133932-76133954 CTCCATGTTGAGAACAAGAGCGG + Intronic
1058062799 9:100515734-100515756 CTCCAGGCTGAGATTCATCCAGG + Intronic
1059352079 9:113672603-113672625 CTCCAGATTGAGATCCTACCAGG - Intergenic
1060104496 9:120865408-120865430 CTCCATGTTGCAACCTAGCCAGG + Intronic
1060245735 9:121944740-121944762 CCCCAGGTTGAATTCCAGCCTGG + Intronic
1060297827 9:122355225-122355247 CTCCATCTTGAGAGCCAACTGGG + Intergenic
1060605246 9:124908312-124908334 CACCATGTTGCCATTCAGCCAGG + Intronic
1062504791 9:136867551-136867573 CTCAATGTTGTGCTCCAGCGTGG - Intronic
1062708386 9:137957717-137957739 CTCCATGTCCAGCTCAAGCCTGG - Intronic
1185819274 X:3186029-3186051 AGCCATGTTCACATCCAGCCTGG + Intergenic
1185987343 X:4850087-4850109 TCACATTTTGAGATCCAGCCAGG + Intergenic
1186608837 X:11119054-11119076 CTCCATTTTCTGACCCAGCCTGG + Intronic
1190888505 X:54549672-54549694 GCCACTGTTGAGATCCAGCCTGG + Intronic
1192146574 X:68686654-68686676 CTCCTTGTTTGGTTCCAGCCCGG + Intronic
1196001151 X:110787578-110787600 CTCTATTGTGAGAGCCAGCCAGG - Intronic
1199210760 X:145206831-145206853 CTGAATGGTGAGTTCCAGCCAGG + Intergenic
1199881504 X:151977120-151977142 TTCCAAATTGAGAGCCAGCCAGG + Intergenic