ID: 914975971

View in Genome Browser
Species Human (GRCh38)
Location 1:152362668-152362690
Sequence GGTCCAAGTGGACAGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914975964_914975971 22 Left 914975964 1:152362623-152362645 CCTTAGTTTACCCTCTGTAATAA No data
Right 914975971 1:152362668-152362690 GGTCCAAGTGGACAGATAGCAGG No data
914975966_914975971 12 Left 914975966 1:152362633-152362655 CCCTCTGTAATAATCATAGGTGT No data
Right 914975971 1:152362668-152362690 GGTCCAAGTGGACAGATAGCAGG No data
914975967_914975971 11 Left 914975967 1:152362634-152362656 CCTCTGTAATAATCATAGGTGTT No data
Right 914975971 1:152362668-152362690 GGTCCAAGTGGACAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914975971 Original CRISPR GGTCCAAGTGGACAGATAGC AGG Intergenic
No off target data available for this crispr