ID: 914976720

View in Genome Browser
Species Human (GRCh38)
Location 1:152371299-152371321
Sequence TATGATGCTGAGTATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914976720_914976725 26 Left 914976720 1:152371299-152371321 CCTTGCTCATACTCAGCATCATA No data
Right 914976725 1:152371348-152371370 ACTATAGGTTAGAAAGGAAGAGG No data
914976720_914976723 11 Left 914976720 1:152371299-152371321 CCTTGCTCATACTCAGCATCATA No data
Right 914976723 1:152371333-152371355 AGTCAGTGCAATGAGACTATAGG No data
914976720_914976724 20 Left 914976720 1:152371299-152371321 CCTTGCTCATACTCAGCATCATA No data
Right 914976724 1:152371342-152371364 AATGAGACTATAGGTTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914976720 Original CRISPR TATGATGCTGAGTATGAGCA AGG (reversed) Intergenic
No off target data available for this crispr