ID: 914978203

View in Genome Browser
Species Human (GRCh38)
Location 1:152386923-152386945
Sequence CTGTGTGCCCAGAACTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914978201_914978203 13 Left 914978201 1:152386887-152386909 CCAGGTTCTGTACAATCTAAGTA No data
Right 914978203 1:152386923-152386945 CTGTGTGCCCAGAACTAAGTAGG No data
914978200_914978203 14 Left 914978200 1:152386886-152386908 CCCAGGTTCTGTACAATCTAAGT No data
Right 914978203 1:152386923-152386945 CTGTGTGCCCAGAACTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914978203 Original CRISPR CTGTGTGCCCAGAACTAAGT AGG Intergenic
No off target data available for this crispr