ID: 914986163

View in Genome Browser
Species Human (GRCh38)
Location 1:152458970-152458992
Sequence AAGCGGGGCCCTGTGTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914986163_914986167 -7 Left 914986163 1:152458970-152458992 CCCAAAGACACAGGGCCCCGCTT No data
Right 914986167 1:152458986-152459008 CCCGCTTAAGACCCCACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914986163 Original CRISPR AAGCGGGGCCCTGTGTCTTT GGG (reversed) Intergenic
No off target data available for this crispr